Template:Original EILD part sequence

From OpenWetWare
Jump to: navigation, search

GTTAAAGAACTGGAAGACAAAAACGAAGAACTGCTGTCTGAAATCTACCACCTGGACAACGAAGTTGCTCGTCTGAAAAAACTGGTTGGTGAACGTGGTGGTTGC