Search results

From OpenWetWare
Jump to navigationJump to search
  • /home/trait/core/snpedia.py- Outputs tab-separated variant information (into data/snpedia.txt) for each entry in SNPedia /home/trait/core/snpedia_print_genotypes
    13 KB (2,045 words) - 21:08, 10 December 2009
  • more. DUE Tue 29-Sep: Familiarize yourself with OMIM, GeneTests, and SNPedia and note on your talk page at least one big concept for Human2.0 and at
    3 KB (421 words) - 10:51, 12 October 2009
  • thus allows scientists to get credit for - every contribution that's made. SNPedia shares information about the effects of variations in your DNA, citing peer-reviewed
    6 KB (755 words) - 17:12, 17 September 2013
  •        People        Publications        Courses        Contact        SNPedia Gene World by Erik Corona Cell Biology by the Numbers YouTube Channel Case
    2 KB (235 words) - 13:52, 17 January 2019
  • in the BSN gene, rs17234657, rs1000113, rs10761659 and many more.- www.snpedia.com Primer Design Rs11805303: Sequences: TGCTTGCAAACAGAGAACTGTTTCCT
    8 KB (0 words) - 17:06, 10 December 2012
  • ability). A starting point for this kind of work is to cross-reference the SNPedia, which catalogs easily/cheaply-testable human SNPs associated with some
    34 KB (5,315 words) - 08:41, 18 December 2009
  • 5x increased risk of Alzheimer’s and decreased age at onset (http://www.snpedia.com/index.php/Rs4934(A;A). There was no information pertaining to Rs4934
    12 KB (0 words) - 10:41, 29 November 2012