Search results
From OpenWetWare
Jump to navigationJump to search
- 43566 8.16 10.62 11.1 pos pos AM 4 89941 0.17 2.27 1.6 pos pos 59749 2.91 2.29 1.92 pos pos AM 5 32298 7.20 9.40 8.4 incomplete pos 26685 7.50 7.20 9.2...9 KB (0 words) - 04:26, 19 December 2013
- diacetate - $82.50 ea --amneetg 19:16, 16 February 2010 (EST) 4 x G2133-10KU Glucose Oxidase from Aspergillus niger - $31.10 ea --amneetg 19:16, 16 February 2010...20 KB (2,544 words) - 15:19, 16 July 2010
- rabbit 95+90 Santa Cruz sc-1004 WB GST 27457701 H-Ras (F235) mAB mouse 21 Santa Cruz sc-29 WB HA-probe (F-7) mAB mouse Santa Cruz sc-7392 WB HPV 18/16-E6 (AB-1)...22 KB (0 words) - 16:35, 10 February 2011
- number of bases. The numbers of bases of the structures are 16, 18 and 20. We anneal them from 90°C to 20°C for 2800 seconds. (μL) We made modified origami...36 KB (2,572 words) - 09:23, 28 October 2012
- C c5.0.16 and 17: bottom lid latches (16) and "splits" (17) oligo 80la c5.0.16.1 TAATTTCCTGACGAGAAACACTTTTTTTAGAGACGACCATAC oligo 30la c5.0.16.2 GGATT...35 KB (134 words) - 20:28, 12 September 2006
- <Appearance><Material diffuseColor='0.16 0.55 0.94'/></Appearance> </Shape></Transform> </Transform> <Transform translation='-90 50 8.5'> <Transform rotation='1...34 KB (5,078 words) - 15:18, 12 March 2012
- . . 13 14 . . . . 139 140 . . . . 265 266 . . . . 16 15 . . . . 142 141 . . . . 268 267 . . . . 17 18 19 20 . . 143 144 145 146 . . 269 270 271 272 ....6 KB (521 words) - 14:36, 27 July 2006
- seconds) and 750 uL PE buffer(15 seconds), the dried for 90 seconds. The samples were then eluted with 50 uL of water (30 seconds). sbb1103 analytical mapping...13 KB (1,931 words) - 18:38, 21 April 2011
- A., “Cell Motility: Making Connections Count”, Nature 383: 390-391 (1996). 16. Grodzinsky, A.J., R.D. Kamm, and D.A. Lauffenburger, "Quantitative Aspects...50 KB (8 words) - 21:01, 13 December 2005
- Report 100 points Total 380 points Final course grading scale: 94.0-100.0% A 90.0- 93.9% A- 86.0- 89.9% B+ 82.0- 85.9% B 78.0- 81.9% B- 74.0- 77.9% C+ 70...29 KB (2,224 words) - 17:05, 21 March 2017
- 88-111 5 $6.50 $32.50 11/16/2007 Kathy x B500C 11/16/2007 Fisher cyrotube holder 15-350-21 1 $50.95 $50.95 11/14/2007 Jihye x B500C 11/16/2007 Fisher cyrotube...38 KB (119 words) - 03:29, 21 September 2008
- Voigt CA. Genetic parts to program bacteria. Curr Opin Biotechnol. 2006 Oct;17(5):548-57. DOI:10.1016/j.copbio.2006.09.001 | PubMed ID:16978856 | HubMed...4 KB (2,195 words) - 15:42, 3 February 2009
- an intricate structure with complex function. J Biomech. 2012 Jan 3;45(1):17-26. PMID: 21899847 Castillo AB, Blundo JT, Chen JC, Lee KL, Yereddi NR, Jang...22 KB (2,952 words) - 07:48, 1 December 2016
- 00 0.90 0.29 Tyrosine TAT 26180.00 16.32 0.57 Tyrosine TAC 19675.00 12.27 0.43 Phenylalanine TTT 35930.00 22.40 0.57 Phenylalanine TTC 26609.00 16.59 0...5 KB (49 words) - 19:52, 15 September 2014
- to equilibrate to the new temperature (it was previously set to OT:-17°C, CT: -17°C. The head region of the embryo was then gently replaced into a vial...7 KB (552 words) - 02:15, 10 September 2013
- 1542-1547. [16] Hsu, P.Y. and Harmer, S.L. (2012) Circadian phase has profound effects on differential expression analysis. PLoS One, 7(11):e49853 [17] Jones...12 KB (9 words) - 02:33, 26 November 2018
- TTAACCAA cho 15 : TAGGAACG ATATTCAA CCGTTCTA AATGCAAT cho 16 : GCCTGAGT GATACATT TCGCAAAT AAGTACGG cho 17 : TGTCTGGA CCATAAAT CAAAAATC GCGTCCAA cho 18 : TACTGCGG...18 KB (27 words) - 03:55, 23 October 2015
- Add 200 uL of PE or Zymo Wash buffer spin through, discard waste. spin for 90 seconds, full speed to dry. elute with water into a fresh Eppendorf tube,...20 KB (2,681 words) - 21:40, 21 April 2010
- mutation effects on HIV-1 matrix protein binding activities. Journal of virology, 90(12), 5657-5664. Dong, X. N., Xiao, Y., Dierich, M. P., & Chen, Y. H. (2001)...18 KB (3,232 words) - 05:56, 26 March 2020
- and often reaching -16°C. At -17°C The sections began to stick to the glass cover which made it very difficult to mount. For about 50% of the sections I...10 KB (953 words) - 02:14, 10 September 2013