Search results
From OpenWetWare
Jump to navigationJump to search
- . 24 23 22 21 . . 150 149 148 147 . . 276 275 274 273 . . 25 26 27 28 . . 151 152 153 154 . . 277 278 279 280 . . 32 31 30 29 . . 158 157 156 155 . . 284...6 KB (521 words) - 14:36, 27 July 2006
- O'Brien [20] A Beginner's Python Tutorial [21] Python Tutorials List and Links [22] Python:Choose Your GUI Toolkit [23] Building GUI Applications with PythonCard...27 KB (1,648 words) - 03:07, 5 August 2008
- methyltransferases to access H1-containing heterochromatin. Cell 153(1):193-205 [15] Hu, W., Franklin, K.A., Sharrock, R.A., Jones, M.A., Harmer, S.L., and...12 KB (9 words) - 02:33, 26 November 2018
- AAGTTTTCTTGGGTCAGGAAAGAGCAA QR 21' : GAGAAT
CGCTCCAACAGGTCAGGAAAGAGCAA QR 22 : CTTATGCGTAACCCTCGTTTACCACCAGACCG QR 22DH : CTTATGCGTAACCCTCGTTTACCACCAG...25 KB (8 words) - 03:47, 25 October 2014
- Lauffenburger, D.A., "Bacterial Chemotaxis and Microbial Ecology", Microb. Ecol. 22: 175-185 (1991). 10. Ford, R.M., B. . Phillips, J.A. Quinn, and D.A. Lauffenburger...50 KB (8 words) - 21:01, 13 December 2005
- 0, 000 16, 0, 000 17, 0, 000 18, 0, 000 19, 0, 000 20, 0, 000 21, 0, 000 22, 0, 000 23, 0, 000 24, 0, 000 25, 0, 000 26, 0, 000 27, 0, 000 28, 0, 000...17 KB (2,300 words) - 18:43, 29 October 2007
- 0, 000 16, 0, 000 17, 0, 000 18, 0, 000 19, 0, 000 20, 0, 000 21, 0, 000 22, 0, 000 23, 0, 000 24, 0, 000 25, 0, 000 26, 0, 000 27, 0, 000 28, 0, 000...17 KB (2,300 words) - 06:16, 18 August 2008
- methyltransferases to access H1-containing heterochromatin. Cell 153(1):193-205 [10] Hu, W., Franklin, K.A., Sharrock, R.A., Jones, M.A., Harmer, S.L., and...12 KB (1,550 words) - 22:31, 26 August 2016
- 0, 000 16, 0, 000 17, 0, 000 18, 0, 000 19, 0, 000 20, 0, 000 21, 0, 000 22, 0, 000 23, 0, 000 24, 0, 000 25, 0, 000 26, 0, 000 27, 0, 000 28, 0, 000...17 KB (2,300 words) - 17:45, 24 August 2009
- 0, 000 16, 0, 000 17, 0, 000 18, 0, 000 19, 0, 000 20, 0, 000 21, 0, 000 22, 0, 000 23, 0, 000 24, 0, 000 25, 0, 000 26, 0, 000 27, 0, 000 28, 0, 000...17 KB (2,300 words) - 01:58, 7 August 2010
- stress exposes a targetable metabolic vulnerability in cancer. Nature Cell Biol 22 (2020) 476-486 Bi M, Zhang Z, Jiang YZ, Xue P, Wang H, Lai Z, Fu X, De Angelis...55 KB (7,535 words) - 21:26, 13 July 2020
- irrespective of KIT or PDGFRA mutation status." Am J Pathol 2004; 165: 1: 107-13 Munagala K, Tibshirani R, Brown PO "Cancer characterization and feature...44 KB (7,714 words) - 23:48, 8 May 2008
- Crystallization at the Amorphous Atazanavir-Water Interface. CrysEngComm. 22, 3179-3187. http://dx.doi.org/10.1039/C9CE02007A 298. Trasi, N. S., Bhujbal...84 KB (7 words) - 19:53, 20 August 2020
- May;72(5):3412-7. DOI:10.1128/AEM.72.5.3412-3417.2006 | PubMed ID:16672485 | HubMed [107] Antoniewicz MR, Stephanopoulos G, and Kelleher JK. Evaluation of regression...29 KB (0 words) - 23:33, 21 April 2010
- BL21 DE3 pNDL-106 (pGK8-GFP100} T.3.1 NDL-106 BL21 DE3 pNDL-107 (pGK8-GFP170} T.3.1 NDL-107 BL21 DE3 pNDL-108 (pGK8-GFP182} T.3.1 NDL-108 TB10 Wanner Strain...47 KB (157 words) - 22:06, 30 October 2012
- 0, 000 16, 0, 000 17, 0, 000 18, 0, 000 19, 0, 000 20, 0, 000 21, 0, 000 22, 0, 000 23, 0, 000 24, 0, 000 25, 0, 000 26, 0, 000 27, 0, 000 28, 0, 000...16 KB (2,292 words) - 01:58, 7 August 2010
- 0, 000 16, 0, 000 17, 0, 000 18, 0, 000 19, 0, 000 20, 0, 000 21, 0, 000 22, 0, 000 23, 0, 000 24, 0, 000 25, 0, 000 26, 0, 000 27, 0, 000 28, 0, 000...16 KB (2,292 words) - 06:16, 18 August 2008
- 0, 000 16, 0, 000 17, 0, 000 18, 0, 000 19, 0, 000 20, 0, 000 21, 0, 000 22, 0, 000 23, 0, 000 24, 0, 000 25, 0, 000 26, 0, 000 27, 0, 000 28, 0, 000...16 KB (2,292 words) - 17:45, 24 August 2009
- 0, 000 16, 0, 000 17, 0, 000 18, 0, 000 19, 0, 000 20, 0, 000 21, 0, 000 22, 0, 000 23, 0, 000 24, 0, 000 25, 0, 000 26, 0, 000 27, 0, 000 28, 0, 000...16 KB (2,292 words) - 17:05, 20 November 2007
- 2, 22.9, 22.8, 19.9, 19.8, 19.6, 17.5, 16.4, 12.3, 12.2, 11.4; ES-HRMS m/z calcd for C55H75N4O5 [M+H]+: 871.5732; found 871.5737; mp (uncorr.) 107.3-110...36 KB (7,073 words) - 15:36, 25 October 2013