42
edits
BME103:W930 Group5 l2: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
→Research and Development
| Line 170: | Line 170: | ||
In the above sequence for the acute myeloid leukemia disease allele, the mutation occurs at the A/C mutation site. For a non-disease bearing allele, C will be coded in the sequence. For the disease bearing allele, A will be coded in place of C, resulting in a missense mutation. | In the above sequence for the acute myeloid leukemia disease allele, the mutation occurs at the A/C mutation site. For a non-disease bearing allele, C will be coded in the sequence. For the disease bearing allele, A will be coded in place of C, resulting in a missense mutation. | ||
Forward primer sequence (while reading left to right, 5'-3', position indicated is 36259238 to 36259238): GGTCGGCCAGCACCTCCACC | Forward primer sequence (while reading left to right, 5'-3', position indicated is 36259238 to 36259238): GGTCGGCCAGCACCTCCACC | ||
Reverse primer sequence (while reading right to left, 3'-5', 200 coordinates/base pairs to the right): CGTTTGTCGAGGATGGTCTG | Reverse primer sequence (while reading right to left, 3'-5', 200 coordinates/base pairs to the right): CGTTTGTCGAGGATGGTCTG | ||
The diseased allele will give a PCR product because it will be amplified by using the created primers in the polymerase chain reaction. The non-disease allele will not give a PCR product because the primers are specifically coded for the disease-carrying allele containing the wrongfully inserted adenine. | The diseased allele will give a PCR product because it will be amplified by using the created primers in the polymerase chain reaction. The non-disease allele will not give a PCR product because the primers are specifically coded for the disease-carrying allele containing the wrongfully inserted adenine. | ||
