Changes

From OpenWetWare
Jump to navigationJump to search

BISC219/F12: RNAi Lab 7

4 bytes added, 11:15, 13 November 2012
Colony PCR
#Obtain three PCR tubes and lids from your instructor in your team color.
#Label the '''side''' of each PCR tube A, B and C - the marker WILL rub off the top. Tube C will serve as your negative control with no colony added.
#Add 30 ul of master mix to each tube. Your master mix will include: 23 μL H<sub>2</sub>O; 3 μL of PCR buffer (10 mM Tris, 50 mM KCl, 1.5 mM MgCl2 pH 8.3); 0.67 μL of 10 mM dNTPs; 0.67 μL of forward primer (20 μM stock); 0.67 μL of reverse primer (20 μM stock); 1 μL of 2 units/μL Taq polymerase. The primers we are using are for T7 polymerase. Why? <BR>T7 primer sequence:<BR>
Forward 5’GAAATTAATACGACTCACTATAGG <BR>
Reverse 5’ CTTTAATTATGCTGATGATATCC
9,292
edits

Navigation menu