Changes

From OpenWetWare
Jump to navigationJump to search

BISC219/F12: RNAi Lab 7

134 bytes added, 11:13, 13 November 2012
Colony PCR
#Obtain three PCR tubes and lids from your instructor in your team color.
#Label the '''side''' of each PCR tube A, B and C - the marker WILL rub off the top. Tube C will serve as your negative control with no colony added.
#Add 30 ul of master mix to each tube. Your master mix will include: 23 μL H<sub>2</sub>O; 3 μL of PCR buffer (10 mM Tris, 50 mM KCl, 1.5 mM MgCl2 pH 8.3); 0.67 μL of 10 mM dNTPs; 0.67 μL of forward primer (20 μM stock); 0.67 μL of reverse primer (20 μM stock); 1 μL of 2 units/μL Taq polymerase. The primers we are using are for the T7 polymerase gene: Forward 5’GAAATTAATACGACTCACTATAGGReverse 5’ CTTTAATTATGCTGATGATATCC 
#After each tube has master mix, use the sterile end of an autoclaved toothpick (''not'' the end you are touching) or the end of a sterile micropipet tip and gently touch the center of your colony of interest and pick up a tiny, barely visible amount of the bacteria. DO '''NOT TAKE THE ENTIRE COLONY!!!''' Make sure that you select colonies that are large enough to have a significant amount remaining bacteria after taking your sample.
#Gently twirl the toothpick in the tube or mix the bacteria from the pipet tip with the master mix making SURE that you have gotten it off the tip or toothpick and into the reaction. Discard the toothpick or the tip into your orange autoclave bag.
9,292
edits

Navigation menu