Primers for aiiA gene from Dr Fray.doc

From OpenWetWare
Jump to: navigation, search

aiiA gene from Dr Fray

ATGACAGTAAAGAAGCTTTATTTCGTACCAGCAGGTCGTTGTATGTTGGATCATTCGTCTGTTAACAGTA 
CATTAACACGAGGGGAATTATTAGACTTACCGGTTTGGTGTTATCTTTTGGAGACTGAAGAAGGACCTAT 
TTTAGTAGATACAGGTATGCCAGAAAGTGCGGTTAATAATGAAGGCCTTTTTAACGGTACATTTGTTGAA 
CGGAAGACCTTCTTTATATTATTAGTTCTCACTTACATTTTGATCATGCAGGAGGAAATGGTGCTTTTAC 
AAATACACCGATTATTGTGCAGCGTGCTGAATACGAGGCGGCACAACATAGTGAAGAATATATGAAAGAA 
TGTATATTGCCGAATTTGAAATACAAGATCATTGAAGGGGATTATGAAGTCGTACCAGGAGTTCAATTAT 
TGTATACACCAGGACATACTCCGGGGCATCAGTCGCTATTAATTGAGACAGAAAAATCCGGTCCTGTGTT 
ATTAACGATTGATGCATCTTATACGAAAGAAAATTTTGAAGATGAAGTGCCGTTCGCTGGATTTGATTCG 
GAATTAGCTTTATCTTCAATTAAACGTTTAAAAGAAGTTGTTAGGAAAGAGAACCCAATTGTTTTCTTTG 
GACATGATATAGAGCAGGAAAAGAGTTGTAAAGTGTTCCCTGAATATATATAG

Components

Degradation Tag + Stop codons

GCTGCAAACGACGAAAACTACGCTTTAGTAGCTTAATAA

Epitope tag + start codon

ATGGATTATAAAGATGATGATGATAAAGGT

Desired Sequence

We are cutting with spe1 and ecoR1 so the 3’end can have the Pst1 restrection site removed to shorten the primers

Restriction Sites-Epitope tag-gene Degradation tag-Restriction Sites

GAATTCGCGGCCGCATCTAGAGATGGATTATAAAGATGATGATGATAAAGGTATGACAGTAAAGAAGCTT 70
TATTTCGTACCAGCAGGTCGTTGTATGTTGGATCATTCGTCTGTTAACAGTACATTAACACGAGGGGAAT 140
TATTAGACTTACCGGTTTGGTGTTATCTTTTGGAGACTGAAGAAGGACCTATTTTAGTAGATACAGGTAT 210
GCCAGAAAGTGCGGTTAATAATGAAGGCCTTTTTAACGGTACATTTGTTGAAGGACATATTTTACCAAAA 280
ATGACTGAAGAAGATAGAATCGTGAATATTTTAAAACGCGTTGGTTATGAGCCGGAAGACCTTCTTTATA 350
TTATTAGTTCTCACTTACATTTTGATCATGCAGGAGGAAATGGTGCTTTTACAAATACACCGATTATTGT 420
GCAGCGTGCTGAATACGAGGCGGCACAACATAGTGAAGAATATATGAAAGAATGTATATTGCCGAATTTG 490
AAATACAAGATCATTGAAGGGGATTATGAAGTCGTACCAGGAGTTCAATTATTGTATACACCAGGACATA 560
CTCCGGGGCATCAGTCGCTATTAATTGAGACAGAAAAATCCGGTCCTGTGTTATTAACGATTGATGCATC 630
TTATACGAAAGAAAATTTTGAAGATGAAGTGCCGTTCGCTGGATTTGATTCGGAATTAGCTTTATCTTCA 700
ATTAAACGTTTAAAAGAAGTTGTTAGGAAAGAGAACCCAATTGTTTTCTTTGGACATGATATAGAGCAGG 770
AAAAGAGTTGTAAAGTGTTCCCTGAATATATAGCTGCAAACGACGAAAACTACGCTTTAGTAGCTTAATA 840
ATACTAGTA

Primers

  • 5’end = same as gene.
gaattcgcggccgcatctagagATGgattataaagatgatgatgataaaggtATGACAGTAAAGAAGCTTTATTTCG
  • 3’end = reverse and complementary to gene
TACTAGTATTATTAAGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGCTATATATTCAGGGAACACTTTAC