Koch Lab:Protocols/Sequences/pRL574

From OpenWetWare
(Redirected from Koch Lab:Sequences/pRL574)
Jump to: navigation, search

Notes

  • Sequence for pRL574, from email from Bob Landick.

Sequence

5' CGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATAAAATTGTAAACGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGCCCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCAAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTACTATGGTTGCTTTGACGTATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGATCCAGATCCCGAACGCCTATCTTAAAGTTTAAACATAAAGACCAGACCTAAAGACCAGACCTAAAGACACTACATAAAGACCAGACCTAAAGACGCCTTGTTGTTAGCCATAAAGTGATAACCTTTAATCATTGTCTTTATTAATACAACTCACTATAAGGAGAGACAACTTAAAGAGACTTAAAAGATTAATTTAAAATTTATCAAAAAGAGTATTGACTTAAAGTCTAACCTATAGGATACTTACAGCCATCGAGAGGGACACGGGGGATCCTCTAGAGTGCTTGGCGAACCGGTGTTTGACGTCCAGGAATGTCAAATCCGTGGCGTGACCTATTCCGCACCGCTGCGCGTTAAACTGCGTCTGGTGATCTATGAGCGCGAAGCGCCGGAAGGCACCGTAAAAGACATTAAAGAACAAGAAGTCTACATGGGCGAAATTCCGCTCATGACAGACAACGGTACCTTTGTTATCAACGGTACTGAGCGTGTTATCGTTTCCCAGCTGCACCGTAGTCCGGGCGTCTTCTTTGACTCCGACAAAGGTAAAACCCACTCTTCGGGTAAAGTGCTGTATAACGCGCGTATCATCCCTTACCGTGGTTCCTGGCTGGACTTCGAATTCGATCCGAAGGACAACCTGTTCGTACGTATCGACCGTCGCCGTAAACTGCCTGCGACCATCATTCTGCGCGCCCTGAACTACACCACAGAGCAGATCCTCGACCTGTTCTTTGAAAAAGTTATCTTTGAAATCCGTGATAACAAGCTGCAGATGGAACTGGTGCCGGAACGCCTGCGTGGTGAAACCGCATCTTTTGACATCGAAGCTAACGGTAAAGTGTACGTAGAAAAAGGCCGCCGTATCACTGCGCGCCACATTCGCCAGCTGGAAAAAGACGACGTCAAACTGATCGAAGTCCCGGTTGAGTACATCGCAGGTAAAGTGGTTGCTAAAGACTATATTGATGAGTCTACCGGCGAGCTGATCTGCGCAGCGAACATGGAGCTGAGCCTGGATCTGCTGGCTAAGCTGAGCCAGTCTGGTCACAAGCGTATCGAAACGCTGTTCACCAACGATCTGGATCACGGCCCATATATCTCTGAAACCTTACGTGTCGACCCAACTAACGACCGTCTGAGCGCACTGGTAGAAATCTACCGCATGATGCGCCCTGGCGAGCCGCCGACTCGTGAAGCAGCTGAAAGCCTGTTCGAGAACCTGTTCTTCTCCGAAGACCGTTATGACTTGTCTGCGGTTGGTCGTATGAAGTTCAACCGTTCTCTGCTGCGCGAAGAAATCGAAGGTTCCGGTATCCTGAGCAAAGACGACATCATTGATGTTATGAAAAAGCTCATCGATATCCGTAACGGTAAAGGCGAAGTCGATGATATCGACCACCTCGGCAACCGTCGTATCCGTTCCGTTGGCGAAATGGCGGAAAACCAGTTCCGCGTTGGCCTGGTACGTGTAGAGCGTGCGGTGAAAGAGCGTCTGTCTCTGGGCGATCTGGATACCCTGATGCCACAGGATATGATCAACGCCAAGCCGATTTCCGCAGCAGTGAAAGAGTTCTTCGGTTCCAGCCAGCTGTCTCAGTTTATGGACCAGAACAACCCGCTGTCTGAGATTACGCACAAACGTCGTATCTCCGCACTCGGCCCAGGCGGTCTGACCCGTGAACGTGCAGGCTTCGAAGTTCGAGACGTACACCCGACTCACTACGGTCGCGTATGTCCAATCGAAACCCCTGAAGGTCCGAACATCGGTCTGATCAACTCTCTGTCCGTGTACGCACAGACTAACGAATACGGCTTCCTTGAGACTCCGTATCGTAAAGTGACCGACGGTGTTGTAACTGACGAAATTCACTACCTGTCTGCTATCGAAGAAGGCAACTACGTTATCGCCCAGGCGAACTCCAACTTGGATGAAGAAGGCCACTTCGTAGAAGACCTGGTAACTTGCCGTAGCAAAGGCGAATCCAGCTTGTTCAGCCGCGACCAGGTTGACTACATGGACGTATCCACCCAGCAGGTGGTATCCGTCGGTGCGTCCCTGATCCCGTTCCTGGAACACGATGACGCCAACCGTGCATTGATGGGTGCGAACATGCAACGTCAGGCCGTTCCGACTCTGCGCGCTGATAAGCCGCTGGTTGGTACTGGTATGGAACGTGCTGTTGCCGTTGACTCCGGTGTAACTGCGGTAGCTAAACGTGGTGGTGTCGTTCAGTACGTGGATGCTTCCCGTATCGTTATCAAAGTTAACGAAGACGAGATGTATCCGGGTGAAGCAGGTATCGACATCTACAACCTGACCAAATACACCCGTTCTAACCAGAACACCTGTATCAACCAGATGCCGTGTGTGTCTCTGGGTGAACCGGTTGAACGTGGCGACGTGCTGGCAGACGGTCCGTCCACCGACCTCGGTGAACTGGCGCTTGGTCAGAACATGCGCGTAGCGTTCATGCCGTGGAATGGTTACAACTTCGAAGACTCCATCCTCGTATCCGAGCGTGTTGTTCAGGAAGACCGTTTCACCACCATCCACATTCAGGAACTGGCGTGTGTGTCCCGTGACACCAAGCTGGGTCCGGAAGAGATCACCGCTGACATCCCGAACGTGGGTGAAGCTGCGCTCTCCAAACTGGATGAATCCGGTATCGTTTACATTGGTGCGGAAGTGACCGGTGGCGACATTCTGGTTGGTAAGGTAACGCCGAAAGGTGAAACTCAGCTGACCCCAGAAGAAAAACTGCTGCGTGCGATCTTCGGTGAGAAAGCCTCTGACGTTAAAGACTCTTCTCTGCGCGTACCAAACGGTGTATCCGGTACGGTTATCGACGTTCAGGTCTTTACTCGCGATGGCGTAGAAAAAGACAAACGTGCGCTGGAAATCGAAGAAATGCAGCTCAAACAGGCGAAGAAAGACCTGTCTGAAGAACTGCAGATCCTCGAAGCGGGTCTGTTCAGCCGTATCCGTGCTGTGCTGGTAGCCGGTGGCGTTGAAGCTGAGAAGCTCGACAAACTGCCGCGCGATCGCTGGCTGGAGCTGGGCCTGACAGACGAAGAGAAACAAAATCAGCTGGAACAGCTGGCTGAGCAGTATGACGAACTGAAACACGAGTTCGAGAAGAAACTCGAAGCGAAACGCCGCAAAATCACCCAGGGCGACGATCTGGCACCGGGCGTGCTGAAGATTGTTAAGGTATATCTGGCGGTTAAACGCCGTATCCAGCCTGGTGACAAGATGGCAGGTCGTCACGGTAACAAGGGTGTAATTTCTAAGATCAACCCGATCGAAGATATGCCTTACGATGAAAACGGTACGCCGGTAGACATCGTACTGAACCCGCTGGGCGTACCGTCTCGTATGAACATCGGTCAGATCCTCGAAACCCACCTGGGTATGGCTGCGAAAGGTATCGGCGACAAGATCAACGCCATGCTGAAACAGCAGCAAGAAGTCGCGAAACTGCGCGAATTCATCCAGCGTGCGTACGATCTGGGCGCTGACGTTCGTCAGAAAGTTGACCTGAGTACCTTCAGCGATGAAGAAGTTATGCGTCTGGCTGAAAACCTGCGCAAAGGTATGCCAATCGCAACGCCGGTGTTCGACGGTGCGAAAGAAGCAGAAATTAAAGAGCTGCTGAAACTTGGCGACCTGCCGACTTCCGGTCAGATCCGCCTGTACGATGGTCGCACTGGTGAACAGTTCGAGCGTCCGGTAACCGTTGGTTACATGTACATGCTGAAACTGAACCACCTGGTCGACGACAAGATGCACGCGCGTTCCACCGGTTCTTACAGCCTGGTTACTCAGCAGCCGCTGGGTGGTAAGGCACAGTTCGGTGGTCAGCGTTTCGGGGAGATGGAAGTGTGGGCGCTGGAAGCATACGGCGCAGCATACACCCTGCAGGAAATGCTCACCGTTAAGTCTGATGACGTGAACGGTCGTACCAAGATGTATAAAAACATCGTGGACGGCAACCATCAGATGGAGCCGGGCATGCGAGAGTAGGGAACTGCCAGGCATCAAAGAAAACGAAAGGCACAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTCCTGTCGTCATATCTACAAGCCATCCCCCCACAGATACGGTAAACTAGCCTCGTTTTTGCATCAGGAAAGCAGAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCT 3'