IGEM:UW/2008/Notebook/iGEM UW Team/2008/05/22

From OpenWetWare
Jump to: navigation, search
Igem-logo-150px.png University of Warsaw iGEM Team 2008 Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

1. Design of primers for sequencing something we want from pMPM-T5

Primers:

pMPMT5seqF CTACTGTTTCTCCATACCCG

pMPMT5seqR GAAAATCTTCTCTCATCCGC

AIDseqP GCTTCGGCGCATCCTTTTG