IGEM:UW/2008/Notebook/iGEM UW Team/2008/05/08

From OpenWetWare
Jump to: navigation, search
Igem-logo-150px.png University of Warsaw iGEM Team 2008 Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

1. Design primers for AID and T7 RNA-polimerase

Primer sequences:

T7lLinkB  CGGATCCGGCGGTGGCGGTAGTGGAGGAGGTGGGTCTGGAGGCGGAGGGAACACGATTAACATCGCTAAGAAC
T7lRBSHi  CACAAGCTTAGGAGGTGTACTAGATGAACACGATTAACATCGCTAAG
T7pXbSal  TCTGTCGACTCTAGATTACGCGAACGCGAAGTCC
AIDlNrH   CGTAAGCTTAGGAGGTGTAGACCATGGACAGCCTCTTGATG
AIDpLinB  CCACTACCGCCACCGCCGGATCCGCCACCTCCGCTGCCTCCACCACCAAGTCCCAAAGTACGAAATGC