IGEM:UNAM/2009/Notebook/Modeling logbook Claudia/2010/09/09

From OpenWetWare
Jump to: navigation, search
TeamLogo.jpg UNAM-Genomics-Mexico team Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Working on LovTAP.Reporter systems: PCR to fuse trpL promoter

In order to construct the reporter system regulated by LovTAP, I and Zepeda are working together to fuse the promoter trpL with a reporter gene. As we are interested in characterize LovTAP activator and repressor activity. We have designed the following constructions.

  • LovTAP repressor activity: Reporter system

trpL promoter fused to GFP protein:Part:BBa_E0240

  • LovTAP activator activity: Reporter system

trpL promoter fused to lambda Repressor cI: Part:BBa_P0451 + Part:BBa_K098991 regulating GFP protein:Part:BBa_E0240

Both constructions will be inserted in plasmid pSB3K3 for measurements.

Experimental Setup

1.Insert the trpL promoter through a PCR reaction to the plasmid pSB1C3.

-trpL promoter sequence

tggcaaatattctgaaatgagctgttgacaattaatcatcgaactagttaactagtacgcAagttcacgtaaaaagggtat

Primers designed:

-Primer_trpL_reverse (5'->3'): SpeI site + trpL promoter + XbaI site + EcoRI site GGACTAGTCCCTTGCGTACTAGTTAACTAGTTCGATGATTAATTGTCAACAGCCTCTAGAAGCGGCCGCGAATTC

-Primer forward (5'->3'): Suffix

-Template: Plasmid pSB1C3

  • PCR taq platinum reaction mixture
Reactive Quantity
Buffer 10X PCR Buffer minus M 5μL
10mM dNTP mixture 1μL
50mM MgCl2 1.5μL
Primer mix (10μΜ each) 1μL each
Template DNA (plasmid pSB1C3) 1μL
Platinum Taq DNA polymerase 0.2μL
HPLC Up to a final volume of 50 μL of the mixture (39.3 μL)
  • 35 PCR programmed cycles:

The reaction starts at 95°C during 5 min.

Each cycle is programmed as follows:

Temperature Time
94°C 45s
55°C 45s
72°C 2:30 min

After the cycle 35, the temperature changes to 72°C during 5 min and ends at 4°C.

Results:PCR with promoter trpL

Taq platinum PCR trpL+pSB1C3. Lane1:Ladder. Lane8: trpL+pSB1C3 Tm at 55° Replica 1. Lane9: trpL+pSB1C3 Tm at 55° Replica 2.The other lanes are samples from other experiments.Sample loaded 3μL.