IGEM:UNAM/2009/Notebook/Modeling logbook Claudia/2010/08/30

UNAM-Genomics-Mexico team

Main project page Previous entry      Next entry

Working on LovTAP.Reporter systems In order to construct the reporter system regulated by LovTAP, I and Zepeda are working together to fuse the promoter trpL with a reporter gene. As we are interested in characterize LovTAP activator and repressor activity. We have designed the following constructions. LovTAP repressor activity: Reporter system trpL promoter fused to GFP protein:Part:BBa_E0240 LovTAP activator activity: Reporter system trpL promoter fused to lambda Repressor cI: Part:BBa_P0451 + Part:BBa_K098991 regulating GFP protein:Part:BBa_E0240 Both constructions will be inserted in plasmid pSB3K3 for measurements. Experimental Setup 1.Insert the trpL promoter through a PCR reaction to the plasmid pSB3K3. -trpL promoter sequence tggcaaatattctgaaatgagctgttgacaattaatcatcgaactagttaactagtacgcAagttcacgtaaaaagggtat Primers designed: -Primer_trpL_reverse (5'->3'): SpeI site + trpL promoter + XbaI site + EcoRI site GGACTAGTCCCTTGCGTACTAGTTAACTAGTTCGATGATTAATTGTCAACAGCCTCTAGAAGCGGCCGCGAATTC -Second Primer_trpL_reverse (5'->3'): NheI site + a region of the trpL promoter TTGCTAGCTGAACTTGCGTACTAGTTAACTAGTTCGATG -Primer forward: Suffix (5'->3'):TAC TAG TAG CGG CCG CTG CAG -Template: Plasmid pSB3K3 LovTAP repressor activity: Reporter system 2.Transform and isolate the plasmid pSB1A2 harboring the part BBa_E0240 (RBS+GFP protein). 3.Fuse the trpL-pSB3K3 construction to the part BBa_E0240. LovTAP activator activity: Reporter system 4.Transform and isolate the plasmids pSB1AK3 and pSB1A2, harboring the parts BBa_P0451 (RBS+cI repressor) and BBa_K098991(cI regulated promoter+RBS+GFP) respectively. Fuse them to construct the whole cI inverter regulating GFP protein. Then join the inverter to the trpL-pSB3K3 construction. 5. In order to have a positive control of GFP constituve expresion, we decided to use Part:BBa_I20260(Promoter J23101+RBS+GFP). I have to transform this part. 6. Isolate plasmid pSB3K3 for characterization, pSB3K3 backbone will be isolated from part Part:BBa_J04450. In the next table are all the Parts that will be transformed. Part Plate Well Lenght I20260 2010_2 17F 919 bp K098991 2010_3 1C 933 bp P0451 2010_2 1N 930bp E0240 2010_1 12M 876 bp J04450 2010_1 5E 1010 bp Parts Transformations: Results In order to test the above transformations I did colony PCRs. Using the same previously described protocol. Primer Forward: Prefix Primer Reverse: Suffix The transformed colonies that were selected to make the colony PCR for each Part were the following: Part Colonies I20260 4,2 K098991 8,7 P0451 1,6 E0240 1,5 J4450 8,4 PCR colony Transformations. Lane1:Ladder. Lane5:J4450 colony 8. Lane6:J4450 colony 4.Lane7: P0451 colony 1. Lane8:P0451 colony 6 .Lane9: E0240 colony 1. Lane10: E0240 colony 5. Lane11: I20260 colony 4.Lane12:I20260 colony 2. Lane13: K098991 colony 8.Lane14: K098991 colony 7.The other lanes are samples from other experiments. The sizes of the PCR products are around the expected lenght for each part, but J4450 colony 4 and K098991 colony 7 don´t have the expected parts. So, at least one colony for each part was correctly transformed. I will extract the plasmids using the previously described protocol.