IGEM:Paris Bettencourt 2012/Notebooks/Semantic group/annexe

From OpenWetWare
Jump to: navigation, search
Notebook Design Roadmap Meetings and to-dos Protocols Bibliography Previous Biosafety iGEM projects

Semantic containment project



Prefix 1

Before sequences starting with ATG GAATTCGCGGCCGCTTCTAG

Prefix 2

Before sequences starting with no ATG GAATTCGCGGCCGCTTCTAGAG



Plasmid 1 : pSB3C5::S0/1/6

NB :

  • P- & -S means Prefix and Suffix added

Geneious file : File:Semantic.geneious (right click, save under...)

P-KanR all serines changed-S


Fragment 1


Fragment 2


Plasmid 2 : pSB1A3::supD_T1

BBa_K228001 - SupD-tRNA


BBa_B1006 - Terminator 1

