Haynes Lab:Notebook/HPK-CFP insertion into Gal4EED/Luc using CRISPR/2016/01/12

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.pngToday's project is... Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Overview

Taking the following steps today:

  • PCR of EM7:ZeoR to add BB cut sites
  • Digestion/Ligation of EM7:ZeoR part into v0120 vector
  • Transformation into DH5α-Turbo

EM7:ZeoR PCR

Primers:

primer name sequence Tm (anneal)
EM7_BB_fwd CCTTTCTAGATGTTGACAATTAATCATCGGCATAGTATATCGGC 60.6
ZeoR_BB_rev AAGGCTGCAGCGGCCGCTACTAGTTCAGTCCTGCTCCTCGGCC 60.1

Reaction setup:

Product Primer (For) Primer (Rev) Template
EM7:ZeoR_BB EM7_BB_fwd ZeoR_BB_rev MV8

Prepare master mix:

Reagent Stock Volume (µL)
GC Buffer 5x 20
dNTP mix 10 mM 2
DMSO - 3
Primer (for) 100 µM 1.0
Primer (rev) 100 µM 1.0
Template 100 ng/µL 4.0
Phusion 20 U/µL 1
H2O - 68
100

PCR extension times:

Part Size (bp) Extension time (sec)
EM7:ZeoR_BB 476 30

DNA Quantification

Concentration is measured at 245 ng/µL with 260/280 around 1.9.