User:Bill Flanagan

From OpenWetWare
(Redirected from Bill Flanagan)
Jump to navigationJump to search

My name is Bill Flanagan.


I'm the Senior Technology Developer for OpenWetWare.

My background is in building online systems to facilitate collaboration.


ISBN Function not working: test

isbn=0-4714-1761-0

ISBN 0812974425

BBa K404201

OGG Video File

File: Big_Buck_Bunny_small

Biblio Test

  1. Goldbeter A and Koshland DE Jr. An amplified sensitivity arising from covalent modification in biological systems. Proc Natl Acad Sci U S A. 1981 Nov;78(11):6840-4. DOI:10.1073/pnas.78.11.6840 | PubMed ID:6947258 | HubMed [Goldbeter-PNAS-1981]
  2. JACOB F and MONOD J. Genetic regulatory mechanisms in the synthesis of proteins. J Mol Biol. 1961 Jun;3:318-56. DOI:10.1016/s0022-2836(61)80072-7 | PubMed ID:13718526 | HubMed [Jacob-JMB-1961]

    you can even leave a comment on a paper

  3. ISBN:0879697164 [Ptashne-Genetic-Switch]
  4. http://openwetware.org

    [Website]

All Medline abstracts: PubMed | HubMed

Contact

  • For OWW logged-in members: Click Here
  • Email: bill at openwetware dot org
Error creating thumbnail: File missing
This selection of articles can be downloaded as a PDF book (or as html only)
(see Pdf Book extension for details about this functionality)


Google Docs

<GoogleDocs />

Microsoft Research Delivers Tools to Help Accelerate Scientific Discovery

Microsoft Research Delivers Tools to Help Accelerate Scientific Discovery

Workflow technology for scientists connects raw data to computing systems, facilitating research in oceanography, astronomy, environmental science and other disciplines.

   * Press Release
   * Source: Microsoft Corp.
   * On Monday July 13, 2009, 12:30 pm EDT


REDMOND, Wash., July 13 /PRNewswire-FirstCall/ -- Addressing an audience of prominent academic researchers today at the 10th annual Microsoft Research Faculty Summit, Microsoft External Research Corporate Vice President Tony Hey announced that Microsoft Corp. has developed new software tools with the potential to transform the way much scientific research is done. Project Trident: A Scientific Workflow Workbench allows scientists to easily work with large volumes of data, and the specialized new programs Dryad and DryadLINQ facilitate the use of high-performance computing.

Created as part of the company's ongoing efforts to advance the state of the art in science and help address world-scale challenges, the new tools are designed to make it easier for scientists to ingest and make sense of data, get answers to questions at a rate not previously possible, and ultimately accelerate the pace of achieving critical breakthrough discoveries. Scientists in data-intensive fields such as oceanography, astronomy, environmental science and medical research can now use these tools to manage, integrate and visualize volumes of information. The tools are available as no-cost downloads to academic researchers and scientists at http://research.microsoft.com/en-us/collaboration/tools.

"Today, scientists can collect more data than ever before from the Internet, satellites, sensors and other resources," Hey said. "That deluge of information brings amazing research opportunities, but at the same time, our ability to process that data and make it meaningful has not kept pace. These tools help simplify the data-intensive end of research, so scientists can focus on analyzing results and making new discoveries."

Transforming a Discipline

Project Trident is allowing oceanographic researchers to manage the massive amounts of scientific data coming in from sensors, instruments, moorings, robots and cameras attached to fiber-optic cables on the ocean floor. The data will be used to better understand sediment flows, changes in temperature and salinity, earthquakes, undersea volcanoes, extreme life forms associated with seafloor hydrothermal vents, and what data is needed to predict tsunamis.

Project Trident is currently being used by oceanographers at the University of Washington to support the Ocean Observatories Initiative (OOI), a seafloor-based research network sponsored by the National Science Foundation with thousands of sensors in the oceans of the Western Hemisphere. The amount of data coming in from these sensors is roughly equal to two simultaneous high-definition TV broadcasts going around the clock.

Project Trident is also being used by oceanographers at the Monterey Bay Aquarium Research Institute to support a data portal for a program funded by the Office of Naval Research designed to better understand typhoon intensification.

"In the ocean sciences we routinely work with complex multidisciplinary data sets, and the investigator often spends more time on the mechanics of finding and manipulating data than on the process of understanding what the data means," said James G. Bellingham, chief technologist, Monterey Bay Aquarium Research Institute. "Trident's workflow framework provides a graphical environment that hides much of the complexity from the user, letting scientists focus their intellectual energy on the data rather than the software."

In addition, astronomers at Johns Hopkins University are using Project Trident to support the Panoramic Survey Telescope and Rapid Response System (Pan-STARRS) project, which helps detect objects in the solar system that might pose a threat to Earth. The Pan-STARRS project uses an array of very powerful digital cameras to observe the entire night sky several times each month. Each of the cameras captures 1.4 gigapixels -- 200 times the resolution of a 7-megapixel consumer camera.

"This is an amount of raw data so large it's difficult to comprehend, much less work with," said Alex Szalay, Alumni Centennial Professor at Johns Hopkins University. "With Project Trident, we can essentially digest that tremendous data source directly into our supercomputers customized for data-intensive science, process it interactively and create complex statistical analyses to help us better understand what's going on in the universe."


Harnessing Technology for Science

Project Trident was developed by Microsoft Research's External Research Division specifically to support the scientific community. Project Trident is implemented on top of Microsoft's Windows Workflow Foundation, using the existing functionality of a commercial workflow engine based on Microsoft SQL Server and Windows HPC Server cluster technologies. DryadLINQ is a combination of the Dryad infrastructure for running parallel systems, developed in the Microsoft Research Silicon Valley lab, and the Language-Integrated Query (LINQ) extensions to the C# programming language. Dryad was designed to simplify the task of implementing distributed applications on clusters of Windows-based computers. DryadLINQ is an abstraction layer, which simplifies the process of implementing Dryad-based applications.

The DryadLINQ system automatically and transparently translates and executes the queries on large compute clusters using the Dryad execution engine. A DryadLINQ program can be written and debugged using standard .NET development tools, and it makes distributed computing on large clusters simple for most programmers.

Reducing Research Overhead

Project Trident combines gaming graphics with workflow technologies to create a powerful visualization tool that makes large-scale, complex scientific data not only easy to review and analyze, but also easy to manage, reproduce and share. It enables researchers to build experiments that formerly required heavy involvement from computer scientists. To give the solution enough "horsepower" to process very large data sets, Dryad and DryadLINQ allow Project Trident to be run on distributed systems or large compute clusters.

"With the addition of DryadLINQ, our ability to interpret data has finally caught up with our ability to collect it," said Roger Barga, a Microsoft researcher and principal architect for the new tools. "While it is not necessary to couple Project Trident with Dryad, the combination provides a powerful system for processing very large volumes of data."

The marriage of visualization and workflow technologies allows data analysis experiments to be developed visually as "workflows," similar to process workflows used in the business world. Whereas building such a system has traditionally required custom coding and weeks or months of development time, with Project Trident, senior researchers can do much of that upfront programming themselves in just hours or days.

About Microsoft External Research

The External Research Division of Microsoft Research builds relationships between academia, industry and government to help advance research in fields that rely heavily upon advanced computing. Microsoft Research provides the tools, technologies, resources and interoperability needed to accelerate research and advance human potential and the well-being of the planet.

About Microsoft Research

Founded in 1991, Microsoft Research is dedicated to conducting both basic and applied research in computer science and software engineering. Its goals are to enhance the user experience on computing devices, reduce the cost of writing and maintaining software, and invent novel computing technologies. Researchers focus on more than 55 areas of computing and collaborate with leading academic, government and industry researchers to advance the state of the art in such areas as graphics, speech recognition, user-interface research, natural language processing, programming tools and methodologies, operating systems and networking, and the mathematical sciences. Microsoft Research currently employs more than 850 people in six labs located in Redmond, Wash.; Cambridge, Mass.; Silicon Valley, Calif.; Cambridge, England; Beijing, China; and Bangalore, India. Microsoft Research collaborates openly with colleges and universities worldwide to enhance the teaching and learning experience, inspire technological innovation, and broadly advance the field of computer science. More information can be found at http://research.microsoft.com.

About Microsoft

Founded in 1975, Microsoft (Nasdaq: MSFT - News) is the worldwide leader in software, services and solutions that help people and businesses realize their full potential.

Online Scientific Data Curation, Publication, and Archiving

Online Scientific Data Curation, Publication, and Archiving

Jim Gray, Alexander S. Szalay, Ani R. Thakar, Christopher Stoughton, and Jan Vandenberg

August 2002

Science projects are data publishers. The scale and complexity of current and future science data changes the nature of the publication process. Publication is becoming a major project component. At a minimum, a project must preserve the ephemeral data it gathers. Derived data can be reconstructed from metadata, but metadata is ephemeral. Longer term, a project should expect some archive to preserve the data. We observe that pub-lished scientific data needs to be available forever – this gives rise to the data pyramid of versions and to data inflation where the derived data volumes explode. As an example, this article describes the Sloan Digital Sky Survey (SDSS) strategies for data publication, data access, curation, and preservation.

<showpdf>http://research.microsoft.com/pubs/64568/tr-2002-74.pdf</showpdf>

In: SPIE Astronomy Telescopes and Instruments

Details

Type: Inproceedings

Pages: 6

Number: MSR-TR-2002-74

Institution: Microsoft Research

Address: Waikoloa, Hawaii

Adobe Advanced Annotations (A3)

Adobe Advanced Annotations (A3)

Erik Wilde (mailto:pdf@dret.net)

Computer Engineering and Networks Laboratory (TIK)

Swiss Federal Institute of Technology (ETH Zurich)

ETH-Zentrum, 8092 Zurich, Switzerland

May 2002

Abstract

PDF in its current for has rather weak support for annotations. This paper describes a usage scenario and how advanced annotations support could make using PDF (and possibly other Adobe applications) more productive. Starting from these observations, different problems are described which could be solved based on different evolutionary steps of the annotation architecture, which has been dubbed “Adobe Advanced Annotations (A3 )”. Following this scenario, some design approaches and a number of implementation issues are discussed.

<showpdf>http://dret.net/netdret/docs/wilde-a3.pdf</showpdf>

DAS

ftp://selab.janelia.org/pub/publications/Dowell01/Dowell01-preprint.pdf

The Distributed Annotation System

Robin D. Dowell1 , Rodney M. Jokerst1 , Allen Day2 , Sean R. Eddy1 , and Lincoln Stein2 ∗

{robin,jokerst,eddy}@genetics.wustl.edu

Howard Hughes Medical Institute

Department of Genetics,

Washington University, St. Louis, MO 63110 USA


{day,lstein}@cshl.org Cold Spring Harbor Laboratory,

1 Bungtown Road, Cold Spring Harbor, NY 11724 USA

Abstract

Background

Currently, most genome annotation is curated by centralized groups with limited resources. Efforts to share annotations transparently among multiple groups have not yet been satisfactory.

Results

Here we introduce a concept called the Distributed Annotation System (DAS). DAS allows sequence annotations to be decentralized among multiple third-party annotators and integrated on an as-needed basis by client-side software. The communication between client and servers in DAS is defined by the DAS XML specification. Annotations are displayed in layers, one per server. Any client or server adhering to the DAS XML specification can participate in the system; we describe a simple prototype client and server example.

Conclusions

The DAS specification is being used experimentally by Ensembl, WormBase, and the Berkeley Drosophila Genome Project. Continued success will depend on the readiness of the research community to adopt DAS and provide annotations. All components are freely available from the project website http://www.biodas.org/.

Annotation

Microsoft: Shared Annotation Notification Paper

Notification for Shared Annotation of Digital Documents

A.J. Bernheim Brush, David Bargeron, Anoop Gupta and Jonathan Grudin

September 19, 2001

Technical Report

MSR-TR-2001-87

Microsoft Research

Microsoft Corporation

One Microsoft Way

Redmond, WA 98052

Notification and shared annotation go hand-in-hand. It is widely recognized that notification of activity in a shared document annotation system helps support awareness and improve asynchronous collaboration. But few studies have examined user needs, and there has been little exploration of design tradeoffs. We examined the large-scale use of notifications in a commercial system, and found it lacking. We designed and deployed enhancements to the system, and then conducted a field study to gauge their effect. We found that providing more information in notification messages, supporting multiple communication channels through which notifications could be received, and allowing customization of notification messages were particularly important. Overall awareness of annotation activity on specs increased with our enhancements.

<showpdf>http://research.microsoft.com/pubs/69880/tr-2001-87.pdf</showpdf>

Online Protocol Annotation

Essay

Online Protocol Annotation: A Method to Enhance Undergraduate Laboratory Research Skills

Julie E. Ruble and Barbara Lom

Biology Department and Neuroscience Program, Davidson College, Davidson, NC

Submitted February 22, 2008; Accepted April 14, 2008

Monitoring Editor: Paul Williams

A well-constructed, step-by-step protocol is a critical starting point for teaching undergraduates new techniques, an important record of a lab’s standard procedures, and a useful mechanism for sharing techniques between labs. Many research labs use websites to archive and share their protocols for these purposes. Here we describe our experiences developing and using a protocol website for the additional purpose of enhancing undergraduate research training. We created our lab’s protocol website in a message board format that allows undergraduates to post comments on protocols describing the lessons they learned, questions that arose, and/or insights they gained while learning to execute specific research protocols. Encouraging and expecting students to comment on the protocols they are learning to execute is beneficial for both the student and for the lab in which they are training. For the student, annotations encourage active reflection on their execution of techniques and emphasize the important message that attending to and understanding details of a protocol is a critical factor in producing reliable data. For the lab, annotations capture valuable insights for future generations of researchers by describing missing details, hints, and common hurdles for newcomers.

CBE—Life Sciences Education Vol. 7, 296 –301, Fall 2008

<showpdf>http://www.lifescied.org/cgi/reprint/7/3/296.pdf</showpdf>

One Big Lab

One Big Lab

A group of students in my human-computer interaction class a few years ago developed an idea called Collaboread for their final project. In essence, it allowed multiple online users to markup a document, enabling collaborative annotation. I'm sure there are several products out there that allow either online markup of documents (Adobe, for one) or collaborative editing (Google Docs), but I haven't seen anything that resembles exactly what I envision.

Neo Note

Suggestions for a Global Shared Scholarly Annotation System

D-Lib Magazine
May/June 2009
Volume 15 Number 5/6

ISSN 1082-9873
NeoNote
Suggestions for a Global Shared Scholarly Annotation System

Bradley Hemminger, Ph.D.
Associate Professor
School of Information and Library Science
University of North Carolina, Chapel Hill
<bmh@ils.unc.edu>

Abstract

There is a need for integrated support for annotation and sharing within the primary tool used for interacting with the World Wide Web, which today is a web browser. Based on prior work and user studies in our research lab, we1 propose design recommendations for a global shared annotation system, for the domain of scholarly research. We describe a system built using these design recommendations (NeoNote), and provide an example video demonstrating the suggested features. Finally, we discuss the major challenges that remain for implementing a global annotation system for sharing scholarly knowledge.

PDF Annotation

Free means to annotate (comment) a PDF?

Posted Dec 2, 2004 19:02 UTC (Thu) by d.e.cox (guest, #3912)

Parent article: The Grumpy Editor's Guide to PDF Viewers

I haven't found a free means to annotate (add little yellow comment boxes) to PDFs. I've used this feature of Adobe's products quite a bit, and it looks to be one of the major improvements in acrobat 7. Anyone know if this kind of capability is in the pipeline of the free readers xpdf, ggv, etc?

Wired

The End of Theory: The Data Deluge Makes the Scientific Method Obsolete

WIRED MAGAZINE: 16.07 Science: Discoveries RSS The End of Theory: The Data Deluge Makes the Scientific Method Obsolete By Chris Anderson Email 06.23.08

"Speaking at the O'Reilly Emerging Technology Conference this past March, Peter Norvig, Google's research director, offered an update to George Box's maxim: "All models are wrong, and increasingly you can succeed without them."

...

"In February, the National Science Foundation announced the Cluster Exploratory, a program that funds research designed to run on a large-scale distributed computing platform developed by Google and IBM in conjunction with six pilot universities."

Information seeking behavior of academic scientists

Research Article

Information seeking behavior of academic scientists

Bradley M. Hemminger 1, Dihui Lu 2, K.T.L. Vaughan 3, Stephanie J. Adams 4

206A Manning Hall, SILS, School of Information and Library Science, University of North Carolina at Chapel Hill, NC. 27599-3360

School of Information and Library Science, University of North Carolina at Chapel Hill

Health Sciences Library, University of North Carolina at Chapel Hill

School of Information and Library Science, University of North Carolina at Chapel Hill

email: Bradley M. Hemminger (bmh@ils.unc.edu)

Index Terms

information seeking • scholars • information resources • electronic publications • online databases

Abstract

The information seeking behavior of academic scientists is being transformed by the availability of electronic resources for searching, retrieving, and reading scholarly materials. A census survey was conducted of academic science researchers at the University of North Carolina at Chapel Hill to capture their current information seeking behavior. Nine hundred two subjects (26%) completed responses to a 15-minute Web-based survey. The survey questions were designed to quantify the transition to electronic communications and how this affects different aspects of information seeking. Significant changes in information seeking behavior were found, including increased reliance on web based resources, fewer visits to the library, and almost entirely electronic communication of information. The results can guide libraries and other information service organizations as they adapt to meet the needs of today's information searchers. Simple descriptive statistics are reported for the individual questions. Additionally, analysis of results is broken out by basic science and medical science departments. The survey tool and protocol used in this study have been adopted for use in a nationwide survey of the information seeking behavior of academic scientists. Received: 14 July 2006; Revised: 14 February 2007; Accepted: 15 February 2007

doi: 10.1002/asi.20686

Biomedical Searching

Hemminger BM, Saelim B, Sullivan PF, Vision TJ, "Comparison of full-text searching to metadata searching for genes in two biomedical literature cohorts", JASIST, 58:14:2341-2352, 2007. <http://dx.doi.org/10.1002/asi.20708>.

doi: 10.1002/asi.20708

Wiki1001

Site URL: http://www.wiki1001.com
OWW Page: http://www.wiki1001.com/wiki/25

Wiki1001.com tracks Internet Wikis. OpenWetWare.org was added recently to it. Take a look at the site. Feel free to say something about OWW (great, good, or otherwise!)

BioBricks

BBa J22001

PMID 123456


>BBa_J22001 Part-only sequence (2630 bp) <dnaseq> aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagtcacacaggaaagtactagatgattaaccgtatccgc gtagtcacgctgttggtaatggtgctgggggtattcgcactgttacagcttatttccggcagtctgtttttttcttcccttcaccatagccagaagagct ttgtggtttccaatcaattacgggaacagcagggcgagctgacgtcaacctgggatttaatgctgcaaacgcgcattaacctgagtcgttcagcggtacg gatgatgatggattcctccaatcaacaaagtaacgccaaagttgaattgctcgatagcgccaggaaaacattggcgcaggcagcgacgcattataaaaaa ttcaaaagcatggcaccgttacctgaaatggtcgctaccagtcgtaatattgatgaaaaatataaaaactattacacagcgttaactgaactgattgatt acctagattatggcaatactggagcttatttcgctcagccaacccagggaatgcaaaatgcaatgggcgaagcgtttgctcagtacgccctcagcagtga aaaactgtatcgcgatatcgtcactgacaacgcagatgattaccgatttgcccagtggcaactggcggttatcgcgctggtggtggtattgattctgctg gtggcgtggtacggcattcgccgtatgttgcttactccgctggcaaaaattattgctcacattcgcgaaatcgccggtggtaacctggcgaataccctga ccattgacgggcgcagtgaaatgggcgacctggcgcagagcgtttcacatatgcaacgctctttgactgacaccgtcactcatgtccgcgaaggttcaga tgccatctatgccggtacccgtgaaattgcggcgggcaacaccgatctttcctcccgtactgaacagcaggcatccgcgctggaagaaactgccgccagc atggagcagctcaccgcgacagtgaagcaaaacgccgataacgcccgccaggcctcgcaactggcgcaaagtgcctccgacaccgcccagcacggcggca aagtggtggatggcgtagtgaaaacgatgcatgagatcgccgatagttcgaagaaaattgccgacattatcagcgttatcgacggtattgccttccagac taatatcctcgcgctgaatgccgcggttgaagccgcgcgtgcgggtgaacagggccgtggttttgccgtggtggcgggtgaagtgcgtaatcttgccagt cgcagcgcccaggcggcaaaagagatcaaagccctcattgaagactccgtctcacgcgttgataccggttcggtgctggtcgaaagcgccggggaaacaa tgaacaatatcgtcaatgctgtcactcgcgtgactgacattatgggcgagattgcatcggcatcggatgaacagagccgtggcatcgatcaagtcgcatt ggcggtttcggaaatggatcgcgtcacgcaacagaacgcatcgctggtgcaggaatcagctgccgccgccgctgcgctggaagaacaggcgagtcgttta acgcaagcagtttccgcgttccgtctggcagccagcccactcaccaataaaccgcaaacaccatcccgtcctgccagtgagcaaccaccggctcagccac gactgcgaattgctgaacaagatccaaactgggaaacattttgatactagagaaagaggagaaatactagatggtgagcaagggcgaggagctgttcacc ggggtggtgcccatcctggtcgagctggacggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctga ccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctggggcgtgcagtgcttcagccgctaccccga ccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgc gccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagt acaactacatcagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcagcgt gcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaa gaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaataatactaga gccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggct caccttcgggtgggcctttctgcgtttata </dnaseq>

Barcodes

References

Examples

Absolute pagename: Generate a simple barcode

<html> <img src='http://chart.apis.google.com/chart?chs=150x150&cht=qr&chl=http://openwetware.org/wiki/User:Bill Flanagan&choe=UTF-8' /> </html>

<html> <img src='http://chart.apis.google.com/chart?chs=150x150&cht=qr&chl=User:Bill Flanagan&choe=UTF-8' /> </html>

Use OWW FULLPAGENAME to generate the pagename:

Size: 100x100

<html> <img src='http://chart.apis.google.com/chart?chs=100x100&cht=qr&chl=http://openwetware.org/wiki/</html>User:Bill Flanagan<html>&choe=UTF-8' /> </html>

Neural Networks

References

Prediction of the response under impact of steel armours using a multilayer perceptron

Impact Time and Point Predicted Using a Neural Extended Kalman Filter

Ballistic Performance Evaluation of Multi-layered Armors using Neural Network Algorithm

Prediction of the behaviour of CFRPs against high-velocity impact of solids employing an artificial neural network methodology

Underground blast induced ground shock and its modelling using artificial neural network

Rankine–Hugoniot equation

Wikipedia: Neural Network

User:Bill Flanagan/docs/Multi-touch screens and neural networks

Error Backpropagation Neural Calibration and Kalman Filter Position Estimation for Touch Panels

Terms

[neural extended]

[Kalman filter]

[multilayered perceptron]

[artificial neural network]

[Rankine-Hugoniot]

AI

Why AI Failed

BioJava

Link: BioJava

BioJava is dedicated to providing a Java framework for processing biological data. It include objects for manipulating biological sequences, file parsers, DAS client and server support, access to BioSQL and Ensembl databases, tools for making sequence analysis GUIs and powerful analysis and statistical routines including a dynamic programming toolkit.

BioJava is used in several real-world bioinformatics applications and has been used for bioinformatics analysis in a number of published studies.

Bitnami

Link: Bitnami

MediaWiki Extension Matrix

Link: Mediawiki Extension Matrix

PHP Tube: PHP Upload class for YouTube

Link: [1]

MediaWiki: Magic Words

Link: Magic Words

DNASis SmartNote

MiraiBio has introduced a free lab notebook on their site free for all users.

You can check it out here.

It's well worth a look.

SmartNote is a bona-fide Web 2.0 application. It relies heavily on Javascript using the Dojo.js Javascript library for much of its interaction. It has many "snap-in" tools for doing analysis of DNA sequences. One of the nice features it has is a genome annotation tool. I'm particularly interested in people's reactions to this particular feature. This is their contact information:

MiraiBio (a Hitachi subsidiary) 601 Gateway Blvd. Suite 100 South San Francisco, CA 94080 800-624-6176 www.miraibio.com

Intro Books on Bioinformatics and PCR

(todo: reformat via biblio/cite with isbn numbers, etc)

From: Aaron Hicks

From: Felix:


From: Michael Vieths

Other:

Quasi-Public-Accessible Biology Lab Facilities

(New content: to be moved to appropriate pages when I have time)

Wake Forest: Babcock Demon Incubator

North Carolina

Website: wfubdi.org/bioscience.php

The incubator can provide fully equipped shared wet lab space for early stage bioscience companies. The wet lab space is located in the Piedmont Triad Research Park. The facilities include chemistry and tissue hoods, gas, air, materials disposal, internet access, etc. A partial list of equipment in the lab can be found on the facilities page. In addition to the use of the wet lab, incubator clients can use break room facilities and schedule conference rooms as required.

Equipment:

  • LCMS, single quad / UPLC system with PDA detector, auto-sampler and column heater
  • UPLC system with PDA detector, auto-sampler, column heater and peptide platform
  • Alliance HPLC system with UV/Vis detector, degas system and column heater
  • GC - 2010, auto injection system
  • Nitrogen Generator – 30 L /min
  • UPS system – 5.2 KV
  • Empower software
  • Classic LAC/E32 Server
  • Oilless vacuum Pump

North Carolina Community College BioNetwork Pharmaceutical Center (NCCBNC)

http://www.ncbionetwork.org/index.cfm?dir=Pharmaceutical/center.cfm&sec=4

The BioNetwork Pharmaceutical Center operates as a collaborative venture between Forsyth Technical Community College and Guilford Technical Community College to serve all community colleges in the state. The administrative offices of the Pharmaceutical Center are located in the Piedmont Triad Research Park.

The Pharmaceutical Center is a statewide liaison between pharmaceutical manufacturing needs and worker training. The Center provides leadership in general pharmaceutical manufacturing to improve the quality of learning, training and services at all NC community colleges and to recruit students for their programs.

The Center also works with economic development leaders in the state to help recruit new companies to North Carolina.

The Center coordinates funded innovation and equipment facility projects as individual colleges expand and enhance the capacity of NC community colleges to educate and train individuals in the biotechnology industry

Just like the NCCCS, the Pharmaceutical Center has partners in industry, commerce, economic development organizations, secondary education, public and private colleges and universities.

Lab Equipment Categories

  • Lab Equipment
  • Analytical Instruments
  • Autoclaves & Sterilizers
  • Centrifuges & Parts
    • Centrifuges
    • Rotors & Parts
    • Other
  • Cleaning Equipment
  • Evaporators
  • Fermenters
  • Furnishings & Facilities
  • Heating & Cooling
    • Burners & Hotplates
    • Cryogenics
    • Environmental Chambers
    • Freezers & Fridges
    • Heating Mantles
    • Hoods
    • Laboratory Furnaces
    • Laboratory Ovens
    • Temperature Monitoring
    • Water Baths & Chillers
    • Other
  • Incubators
  • Lab Lasers & Photonics
  • Lab Scales & Balances
    • Digital Scales & Balances
    • Mechanical & Beam Balances
    • Weights & Calibration Sets
    • Other
  • Microscopes
  • Microscope Parts & Accessories
  • Microtomes
  • Mixers
  • Motion Control
  • Power Supply
  • Pumps
  • Recorders & Plotters
  • Shakers
  • Stirrers
  • Others

Recent Biobricks

<xfeeds>http://partsregistry.org/wiki/index.php?title=Special:Recentchanges&feed=rss</xfeeds>

Representative PCR Models

Perkin Elmer GeneAmp 2400 PCR System Thermal Cycler Perkin Elmer GeneAmp 7500 Realtime Perkin Elmer GeneAmp 9600 Perkin Elmer GeneAmp 9700 Perkin-Elmer GeneAmp 1000 Perkin Elmer Prism 7700 Perkin Elmer Cetus 480 DNA Thermal Cycler Mini Horizontal Electrophoresis PCR Agarose Gel System NewGeneAmp 9600 Thermal Cycler Stratagene Thermocycler model SCS-2 Techne TouchGene Gradient 96 Well Thermal Cycler Techne Genius FGEN02TP Thermal Cycler Hybaid TR3 Omnigene Thermal Cycler Sigma-Aldrich Alumaseal 96 film adhesive plates Biometra Trio-Thermoblock TB-1 Thermocycler Ericomp TwinBlock EZ Thermal Cycler THERMOLYNE BARNSTEAD TEMP-TRONICTHERMAL CYCLER ERICOMP EZ SINGLEBLOCK Thermal Cycler ERICOMP EZ POWERBLOCK II Thermal Cycler Hybaid Omnislide System PCR Thermal Cycler Eppendorf Mastercycler 96 Watt GradientThermal Cycler COY Model 50 TempCycler 35-Well Temperature Cycler

Geshi

<syntaxhighlight lang="php"> <?php

   $v = "string";    // sample initialization

?> html text <?

   echo $v;         // end of php code

?> </syntaxhighlight>

pmid

PMID 20378774