Difference between revisions of "Van Oudenaarden Lab:T01D3.2"

From OpenWetWare
Jump to: navigation, search
 
Line 114: Line 114:
  
 
gaattgaggaaacaaatgtg, hlh-34_40, 40, 945, 35
 
gaattgaggaaacaaatgtg, hlh-34_40, 40, 945, 35
 
----------------------------------------------------------------------
 
Input sequence with probe locations:
 
 
 
atggagactaatctttctgaagaaaaacaaaaaccgtcaaaatcacaagcccagcagagaagacaaatgg
 
  cctctgattagaaagacttc        ttggcagttttagtgttcgg  cgtctcttctgtttacc
 
  Probe # 1, 40% GC            Probe # 2, 45% GC    Probe # 3, 40% GC
 
 
aaaattatgaattctcacagctagccaatgaacttccattggcaagagcaatttctggacagcatattga
 
ttt  tacttaagagtgtcgatcgg  acttgaaggtaaccgttctc  taaagacctgtcgtataact
 
      Probe # 4, 45% GC    Probe # 5, 45% GC    Probe # 6, 35% GC 
 
 
taaaacaacgatggttagattagcaactgcttatatcaaacttcacaatatatttgggcaatctcaaaga
 
    tgttgctaccaatctaatcg  gacgaatatagtttgaagtg  tataaacccgttagagtttc
 
    Probe # 7, 40% GC    Probe # 8, 35% GC      Probe # 9, 35% GC   
 
 
gcctacagttcagctgactattattatggaagtgactctttatggactaacaatcatttagatctactag
 
ggatgtcaagtcgactgata      ccttcactgagaaatacctg      gtaaatctagatgatc
 
Probe # 10, 45% GC        Probe # 11, 45% GC        Probe # 12, 35%
 
 
atggattctttgtgatactggacaggcgcggagatgtactttacataagtgaaactattagtatttactt
 
tacc  agaaacactatgacctgtcc  gcctctacatgaaatgtatt      gataatcataaatgaa
 
GC    Probe # 13, 45% GC    Probe # 14, 35% GC        Probe # 15, 35%
 
 
gggcttgtcacaagttgaaatgactggcaacgcgatggttgattatattcatgaacaggatatcaattgc
 
cccg    gtgttcaactttactgaccg  gcgctaccaactaatataag  cttgtcctatagttaacg
 
GC      Probe # 16, 45% GC    Probe # 17, 40% GC    Probe # 18, 35% GC
 
 
tttaactcggcccttaactattgtgaccttaattggcctcaaatgtgcaacgtacgtgttaaatctagtc
 
aa  tgagccgggaattgataaca  ggaattaaccggagtttaca    gcatgcacaatttagatcag
 
    Probe # 19, 45% GC    Probe # 20, 40% GC      Probe # 21, 40% GC 
 
 
tcacaaagcgagcaaacaaggatgcagttcgtgcttcacctggatacaaggttcttcgtctagaaattac
 
  tgtttcgctcgtttgttcct  gtcaagcacgaagtggacct  gttccaagaagcagatcttt  tg
 
  Probe # 22, 45% GC    Probe # 23, 55% GC    Probe # 24, 40% GC    Pr
 
 
aatgggtccaaatacaaatactagaatgattgcatgttatccaatgcctactccagttctttctacagta
 
ttacccaggtttatgttt    tcttactaacgtacaatagg  acggatgaggtcaagaaaga  cat
 
obe # 25, 35% GC      Probe # 26, 35% GC    Probe # 27, 45% GC    Pro
 
 
accattccttctaattcatttgttatcattacatccatcgatcttcatataacatttgctgatgaaaaag
 
tggtaaggaagattaag        gtaatgtaggtagctagaag          acgactactttttc
 
be # 28, 35% GC          Probe # 29, 40% GC            Probe # 30, 40
 
 
ctcatcagttgcttaataacccattttacccagattcaaatatcaaaggaatgtcattatattcactgat
 
gagtag          ttgggtaaaatgggtctaag        tccttacagtaatataagtg   
 
% GC            Probe # 31, 40% GC          Probe # 32, 30% GC     
 
 
tgatatctcagattctgaagttatatcaaaaatgcatttcgatattttcaacctgggcgcttataaaacc
 
actatagagtctaagacttc            cgtaaagctataaaagttgg    gcgaatattttgg
 
Probe # 33, 35% GC              Probe # 34, 35% GC      Probe # 35, 4
 
 
ccgtactatcgaatgatcttgaatcaaacaagtgaaactttttacgtcgagtcaaatatttttcgtcata
 
ggcatga  gcttactagaacttagtttg  cactttgaaaaatgcagctc        aaagcagtat
 
5% GC    Probe # 36, 35% GC    Probe # 37, 40% GC          Probe # 38
 
 
cttcgatttcctctaaacagtttaatgactcgatcacatttgtttcctcaattctatga
 
gaagctaaag  gatttgtcaaattactgagc  gtgtaaacaaaggagttaag   
 
, 35% GC    Probe # 39, 35% GC    Probe # 40, 35% GC
 

Latest revision as of 19:57, 5 March 2010

Progress:

Probes designed: (03-04-2010 - Christoph Engert)

Probes coupled:

Probes purified:

Probes tested:

Dyes available:


>T01D3.2 (spliced + UTR - 985) gagaaATGGA GACTAATCTT TCTGAAGAAA AACAAAAACC GTCAAAATCA CAAGCCCAGC AGAGAAGACA AATGGAAAAT TATGAATTCT CACAGCTAGC CAATGAACTT CCATTGGCAA GAGCAATTTC TGGACAGCAT ATTGATAAAA CAACGATGGT TAGATTAGCA ACTGCTTATA TCAAACTTCA CAATATATTT GGGCAATCTC AAAGAGCCTA CAGTTCAGCT GACTATTATT ATGGAAGTGA CTCTTTATGG ACTAACAATC ATTTAGATCT ACTAGATGGA TTCTTTGTGA TACTGGACAG GCGCGGAGAT GTACTTTACA TAAGTGAAAC TATTAGTATT TACTTGGGCT TGTCACAAGT TGAAATGACT GGCAACGCGA TGGTTGATTA TATTCATGAA CAGGATATCA ATTGCTTTAA CTCGGCCCTT AACTATTGTG ACCTTAATTG GCCTCAAATG TGCAACGTAC GTGTTAAATC TAGTCTCACA AAGCGAGCAA ACAAGGATGC AGTTCGTGCT TCACCTGGAT ACAAGGTTCT TCGTCTAGAA ATTACAATGG GTCCAAATAC AAATACTAGA ATGATTGCAT GTTATCCAAT GCCTACTCCA GTTCTTTCTA CAGTAACCAT TCCTTCTAAT TCATTTGTTA TCATTACATC CATCGATCTT CATATAACAT TTGCTGATGA AAAAGCTCAT CAGTTGCTTA ATAACCCATT TTACCCAGAT TCAAATATCA AAGGAATGTC ATTATATTCA CTGATTGATA TCTCAGATTC TGAAGTTATA TCAAAAATGC ATTTCGATAT TTTCAACCTG GGCGCTTATA AAACCCCGTA CTATCGAATG ATCTTGAATC AAACAAGTGA AACTTTTTAC GTCGAGTCAA ATATTTTTCG TCATACTTCG ATTTCCTCTA AACAGTTTAA TGACTCGATC ACATTTGTTT CCTCAATTCT ATGAcctcca acttt


Name of probe set: hlh-34

Probes designed on Wed, 03 Mar 10 23:49:08 -0700

40 probes designed for target of length 969

Probe (5'->3'), Probe name, Probe number, Probe position, Percent GC

cttcagaaagattagtctcc, hlh-34_1, 1, 3, 40

ggcttgtgattttgacggtt, hlh-34_2, 2, 32, 45

tttccatttgtcttctctgc, hlh-34_3, 3, 54, 40

ggctagctgtgagaattcat, hlh-34_4, 4, 77, 45

ctcttgccaatggaagttca, hlh-34_5, 5, 99, 45

tcaatatgctgtccagaaat, hlh-34_6, 6, 121, 35

gctaatctaaccatcgttgt, hlh-34_7, 7, 145, 40

gtgaagtttgatataagcag, hlh-34_8, 8, 167, 35

ctttgagattgcccaaatat, hlh-34_9, 9, 190, 35

atagtcagctgaactgtagg, hlh-34_10, 10, 212, 45

gtccataaagagtcacttcc, hlh-34_11, 11, 238, 45

ccatctagtagatctaaatg, hlh-34_12, 12, 265, 35

cctgtccagtatcacaaaga, hlh-34_13, 13, 287, 45

ttatgtaaagtacatctccg, hlh-34_14, 14, 309, 35

gcccaagtaaatactaatag, hlh-34_15, 15, 335, 35

gccagtcatttcaacttgtg, hlh-34_16, 16, 359, 45

gaatataatcaaccatcgcg, hlh-34_17, 17, 381, 40

aagcaattgatatcctgttc, hlh-34_18, 18, 403, 35

acaatagttaagggccgagt, hlh-34_19, 19, 425, 45

acatttgaggccaattaagg, hlh-34_20, 20, 447, 40

gactagatttaacacgtacg, hlh-34_21, 21, 471, 40

tccttgtttgctcgctttgt, hlh-34_22, 22, 493, 45

tccaggtgaagcacgaactg, hlh-34_23, 23, 515, 55

tttctagacgaagaaccttg, hlh-34_24, 24, 537, 40

tttgtatttggacccattgt, hlh-34_25, 25, 559, 35

ggataacatgcaatcattct, hlh-34_26, 26, 583, 35

agaaagaactggagtaggca, hlh-34_27, 27, 605, 45

gaattagaaggaatggttac, hlh-34_28, 28, 628, 35

gaagatcgatggatgtaatg, hlh-34_29, 29, 657, 40

gatgagctttttcatcagca, hlh-34_30, 30, 687, 40

gaatctgggtaaaatgggtt, hlh-34_31, 31, 718, 40

gtgaatataatgacattcct, hlh-34_32, 32, 747, 30

cttcagaatctgagatatca, hlh-34_33, 33, 771, 35

ggttgaaaatatcgaaatgc, hlh-34_34, 34, 804, 35

agtacggggttttataagcg, hlh-34_35, 35, 828, 45

gtttgattcaagatcattcg, hlh-34_36, 36, 850, 35

ctcgacgtaaaaagtttcac, hlh-34_37, 37, 872, 40

gaaatcgaagtatgacgaaa, hlh-34_38, 38, 901, 35

cgagtcattaaactgtttag, hlh-34_39, 39, 923, 35

gaattgaggaaacaaatgtg, hlh-34_40, 40, 945, 35