Difference between revisions of "User talk:Hossein Azari Soufiani"

From OpenWetWare
Jump to: navigation, search
(Report of Second Homework)
(Code for Third Homework)
Line 2: Line 2:
  
 
The paper [[Media:Endy2005.pdf|"Foundations for the Engineering Biology"]] was really interesting.
 
The paper [[Media:Endy2005.pdf|"Foundations for the Engineering Biology"]] was really interesting.
 
==Code for Third Homework==
 
import random
 
import numpy as np
 
 
print
 
print
 
 
Code='cggagcagctcactattcacccgatgagaggggaggagagagagagaaaatgtcctttaggccggttcctcttacttggcagagggaggc
 
tgctattctccgcctgcatttctttttctggattacttagttatggcctttgcaaaggcaggggtatttgttttgatgcaaacctcaatccctccc
 
cttctttgaatggtgtgccccaccccccgggtcgcctgcaacctaggcggacgctaccatggcgtagacagggagggaaagaagtgtgcagaaggc
 
aagcccggaggcactttcaagaatgagcatatctcatcttcccggagaaaaaaaaaaaagaatggtacgtctgagaatgaaattttgaaagagtgc
 
aatgatgggtcgtttgataatttgtcgggaaaaacaatctacctgttatctagctttgggctaggccattccagttccagacgcaggctgaacgtc
 
gtgaagcggaaggggcgggcccgcaggcgtccgtgtggtcctccgtgcagccctcggcccgagccggttcttcctggtaggaggcggaactcgaat
 
tcatttctcccgctgccccatctcttagctcgcggttgtttcattccgcagtttcttcccatgcacctgccgcgtaccggccactttgtgccgtac
 
ttacgtcatctttttcctaaatcgaggtggcatttacacacagcgccagtgcacacagcaagtgcacaggaagatgagttttggcccctaaccgct
 
ccgtgatgcctaccaagtcacagacccttttcatcgtcccagaaacgtttcatcacgtctcttcccagtcgattcccgaccccacctttattttga
 
tctccataaccattttgcctgttggagaacttcatatagaatggaatcaggatgggcgctgtggctcacgcctgcactttggctcacgcctgcact
 
ttgggaggccgaggcgggcggattacttgaggataggagttccagaccagcgtggccaacgtggtg'
 
RCCode=Code
 
TempCode=Code
 
 
print 'Code=',Code
 
print
 
print
 
 
 
pro1=range(1,339)
 
pro2=range(1,339)
 
pro3=range(1,339)
 
prom1=range(1,339)
 
prom2=range(1,339)
 
prom3=range(1,339)
 
 
#----------------------Problem one --------------------------------------------
 
 
 
GCcontent=0
 
for i in range(0,len(Code)-1):
 
 
if Code[i]=='c':
 
  GCcontent=GCcontent+1
 
elif Code[i]=='g':
 
  GCcontent=GCcontent+1
 
 
 
 
 
print 'GC Content=',GCcontent
 
print
 
print
 
print
 
print
 
#----------------------Problem two---------------------------------------------
 
 
for i in range(0,len(Code)-1):
 
 
if  Code[len(Code)-1-i]=='c':
 
  RCCode=RCCode[:i]+'g'+RCCode[i+1:]
 
if  Code[len(Code)-1-i]=='g':
 
  RCCode=RCCode[:i]+'c'+RCCode[i+1:]
 
if  Code[len(Code)-1-i]=='t':
 
  RCCode=RCCode[:i]+'a'+RCCode[i+1:]
 
if  Code[len(Code)-1-i]=='a':
 
  RCCode=RCCode[:i]+'t'+RCCode[i+1:]
 
 
print 'Recerse Complement=:', RCCode
 
print
 
print
 
#----------------------Problem Three---------------------------------------------
 
Here we put the table That I didn't put because it doesn't look good!!!
 
 
for i in range(0,338):
 
 
Temp1=Code[3*i]+Code[3*i+1]+Code[3*i+2]
 
Temp2=Code[3*i+1]+Code[3*i+2]+Code[3*i+3] 
 
Temp3=Code[3*i+2]+Code[3*i+3]+Code[3*i+4]
 
 
pro1[i]=standard[Temp1]
 
pro2[i]=standard[Temp2]
 
pro3[i]=standard[Temp3]
 
 
Temp1=RCCode[3*i]+RCCode[3*i+1]+RCCode[3*i+2]
 
Temp2=RCCode[3*i+1]+RCCode[3*i+2]+RCCode[3*i+3] 
 
Temp3=RCCode[3*i+2]+RCCode[3*i+3]+RCCode[3*i+4]
 
 
prom1[i]=standard[Temp1]
 
prom2[i]=standard[Temp2]
 
prom3[i]=standard[Temp3]
 
 
 
 
print 'Sequence of (+1) frame'
 
print pro1
 
 
print 'Sequence of (+2) frame'
 
print pro2
 
 
print 'Sequence of (+3) frame'
 
print pro3
 
 
print 'Sequence of (-1) frame'
 
print prom1
 
 
print 'Sequence of (-2) frame'
 
print prom2
 
 
print 'Sequence of (-3) frame'
 
print prom3
 
 
 
#-----------------------------Problem Four---------------------------
 
 
counter=0
 
for j in range(0,1000):
 
 
        Code=TempCode
 
        for i in range(0,10):
 
 
                Te=random.random()
 
                Te=np.fix(100*Te)
 
                Te2=random.random()
 
                Te2=int(np.fix(10*Te2))%3
 
               
 
               
 
 
               
 
               
 
                if  (Code[100*i+int(Te)]=='c') and (Te2==1):
 
                      Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:]
 
                     
 
               
 
               
 
                elif  (Code[100*i+int(Te)]=='c') and (Te2==2):
 
                      Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
 
 
               
 
                elif  (Code[100*i+int(Te)]=='c') and (Te2==0):
 
                      Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
 
 
 
 
 
               
 
                elif  (Code[100*i+int(Te)]=='t') and (Te2==1):
 
                      Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:]
 
               
 
               
 
                elif  (Code[100*i+int(Te)]=='t') and (Te2==2):
 
                      Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]
 
 
               
 
                elif  (Code[100*i+int(Te)]=='t') and (Te2==0):
 
                      Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
 
 
 
 
               
 
               
 
                elif  (Code[100*i+int(Te)]=='g') and (Te2==1):
 
                      Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]
 
               
 
               
 
                elif  (Code[100*i+int(Te)]=='g') and (Te2==2):
 
                      Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
 
 
               
 
                elif  (Code[100*i+int(Te)]=='g') and (Te2==0):
 
                      Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
 
 
 
 
 
                elif  (Code[100*i+int(Te)]=='a') and (Te2==1):
 
                      Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:]
 
               
 
               
 
                elif  (Code[100*i+int(Te)]=='a') and (Te2==2):
 
                      Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
 
 
               
 
                elif  (Code[100*i+int(Te)]=='a') and (Te2==0):
 
                      Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]
 
 
             
 
 
 
 
        pro21=range(1,339)
 
        pro22=range(1,339)
 
        pro23=range(1,339)
 
 
 
 
 
        for i in range(0,338):
 
 
                Temp1=Code[3*i]+Code[3*i+1]+Code[3*i+2]
 
                Temp2=Code[3*i+1]+Code[3*i+2]+Code[3*i+3] 
 
                Temp3=Code[3*i+2]+Code[3*i+3]+Code[3*i+4]
 
 
                pro21[i]=standard[Temp1]
 
                pro22[i]=standard[Temp2]
 
                pro23[i]=standard[Temp3]
 
 
               
 
        for i in range(0,len(pro21)-1):
 
 
                if  pro21[i]=='*' and pro1[i]!='*':
 
                        counter=counter+1
 
   
 
 
print 'Percent of Premature Termination=',counter,'/1000'
 
print
 
print
 
 
print 'Before Mutation:', pro1
 
print
 
print
 
 
print 'After Mutation:',  pro21
 
 
input()
 
 
 
 
 
  
  

Revision as of 06:49, 27 May 2010

Report of Second Homework

The paper "Foundations for the Engineering Biology" was really interesting.


December report for project

During this project we started from looking at the dogma of biological systems and we tried to discus on the evolutionary development.

After dividing into groups we as mathematical modeling started to look at a model which encompass the evolutionary notion of development in it. Basically it uses Control theory ideas to design a system which will use a feedback system which optimally will use the experiment results as much as possible.

After proposing our system and having discussion in the class we went forward to an numerical example. After discussions with biology group and infrastructure we got two examples as eye-color and height.

So far we are working on the logistic modeling and we will use this method on the results that infrastructure part will give us from online resources.

Details of our group discussion is on the wiki.

This was a very good initiative for bio processing for me and the way we started to understand the details of this evolving path and start to think together to overcome the problems.

Thanks George a lot for shedding light in this way for us and thanks Harris and Sasha for their helps.

With all the best, Hossein