Difference between revisions of "User:Torsten Waldminghaus/qPCR-Primers"

From OpenWetWare
Jump to: navigation, search
Line 1: Line 1:
{| border="3"
{| border="3"
! Name !! Sequence !! Characteristics !!
! Name !! Sequence !! Characteristics !!Probe set number
! uvrDfw
! uvrDfw
| qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from <cite>Yamazoe-2005</cite>)
| qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from <cite>Yamazoe-2005</cite>)
! uvrDrv   
! uvrDrv   
|qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from <cite>Yamazoe-2005</cite>)
|qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from <cite>Yamazoe-2005</cite>)
|HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from <cite>Yamazoe-2005</cite>
|HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from <cite>Yamazoe-2005</cite>
! yahEFfw  
! yahEFfw  
| qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from <cite>Yamazoe-2005</cite>)
| qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from <cite>Yamazoe-2005</cite>)
! yahEFrv
! yahEFrv
| qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from <cite>Yamazoe-2005</cite>)
| qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from <cite>Yamazoe-2005</cite>)
! yahEFprobe
! yahEFprobe
| HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from <cite>Yamazoe-2005</cite>)
| HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from <cite>Yamazoe-2005</cite>)
|qPCR for GATC-cluster  
|qPCR for GATC-cluster  
|qPCR for GATC-cluster  
|qPCR for GATC-cluster  
|qPCR for GATC-cluster  
|qPCR for GATC-cluster  

Revision as of 01:42, 16 December 2008

Name Sequence Characteristics Probe set number
uvrDfw AGTTCCCGCAGGTGTTTATC qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1]) 1
uvrDrv GTCAGCGTCAGTTTCTGCAT qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1]) 1
uvrDprobe AGACGCCCGCCTTCATCCAG HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1] 1
yahEFfw CCATCGAGACGATCAAAGAA qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) 2
yahEFrv CAGCATCTGGCTTTGTTGTT qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) 2
yahEFprobe AACTCGCGTCCTTCGGCAGC HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) 2
cluster-fw CTGACTGATGAGATCCAACGA qPCR for GATC-cluster 14
cluster-rv CTGGTGCTACGCCTGAATAA qPCR for GATC-cluster 14
cluster-p AAATTCGACCCGGCTGTCGC qPCR for GATC-cluster 14

  1. Yamazoe M, Adachi S, Kanaya S, Ohsumi K, and Hiraga S. Sequential binding of SeqA protein to nascent DNA segments at replication forks in synchronized cultures of Escherichia coli. Mol Microbiol. 2005 Jan;55(1):289-98. DOI:10.1111/j.1365-2958.2004.04389.x | PubMed ID:15612935 | HubMed [Yamazoe-2005]