Difference between revisions of "User:Torsten Waldminghaus/qPCR-Primers"

From OpenWetWare
Jump to: navigation, search
Line 29: Line 29:
 
|CTGACTGATGAGATCCAACGA
 
|CTGACTGATGAGATCCAACGA
 
|qPCR for GATC-cluster  
 
|qPCR for GATC-cluster  
 +
|-
 
!cluster-rv
 
!cluster-rv
 
|CTGGTGCTACGCCTGAATAA
 
|CTGGTGCTACGCCTGAATAA
 
|qPCR for GATC-cluster  
 
|qPCR for GATC-cluster  
 +
|-
 
!cluster-p
 
!cluster-p
 
|AAATTCGACCCGGCTGTCGC
 
|AAATTCGACCCGGCTGTCGC
 
|qPCR for GATC-cluster  
 
|qPCR for GATC-cluster  
 +
|-
 
|}
 
|}
  

Revision as of 02:31, 16 December 2008

Name Sequence Characteristics
uvrDfw AGTTCCCGCAGGTGTTTATC qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1])
uvrDrv GTCAGCGTCAGTTTCTGCAT qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1])
uvrDprobe AGACGCCCGCCTTCATCCAG HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1]
yahEFfw CCATCGAGACGATCAAAGAA qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1])
yahEFrv CAGCATCTGGCTTTGTTGTT qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1])
yahEFprobe AACTCGCGTCCTTCGGCAGC HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1])
cluster-fw CTGACTGATGAGATCCAACGA qPCR for GATC-cluster
cluster-rv CTGGTGCTACGCCTGAATAA qPCR for GATC-cluster
cluster-p AAATTCGACCCGGCTGTCGC qPCR for GATC-cluster


  1. Yamazoe M, Adachi S, Kanaya S, Ohsumi K, and Hiraga S. Sequential binding of SeqA protein to nascent DNA segments at replication forks in synchronized cultures of Escherichia coli. Mol Microbiol. 2005 Jan;55(1):289-98. DOI:10.1111/j.1365-2958.2004.04389.x | PubMed ID:15612935 | HubMed [Yamazoe-2005]