User:Stuart McKellar/Notebook/Bird Sex Testing/2013/01/04: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 24: Line 24:
also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers.
also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers.


Also this page suggests using 1μL of 10μM primer to give final concentration of 0.5μM in 20μL. Maybe I should start running the reactions at 20ul instead.
Mushy primers:
ITS1 5'-TCCGTAGGTGAACCTGCGG-3' forward all
ITS4 5'-TCCTCCGCTTATTGATATGC-3' reverse all





Revision as of 18:29, 3 January 2013

Project name <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Reconciling information and thoughts after break

I did some reading and thinking and research during the xmas break. This is the result.

Housekeeping Genes

Finally found some housekeeping primers: 18S-F908 18S a AGCGAAAGCATTTGCCAAGA 401 This study (SVB) 18S-R1309 18S a AGTCTCGTTCGTTATCGGAATT This study (SVB)

(from http://wwwnc.cdc.gov/eid/article/11/5/05-0211-t1.htm)

Temps and new primers

P2/P8 primers work best at 60C, confirming my lab work. (from http://www.academia.edu/1460726/Sex_Identification_of_Some_Pet_Birds_by_Polymerase_Chain_Reaction-Based_Methods )

also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers.

Also this page suggests using 1μL of 10μM primer to give final concentration of 0.5μM in 20μL. Maybe I should start running the reactions at 20ul instead.


Mushy primers: ITS1 5'-TCCGTAGGTGAACCTGCGG-3' forward all ITS4 5'-TCCTCCGCTTATTGATATGC-3' reverse all