Difference between revisions of "User:Stuart McKellar/Notebook/Bird Sex Testing/2013/01/04"

From OpenWetWare
Jump to: navigation, search
(Temps and new primers)
(fix raw html notebook nav)
 
(2 intermediate revisions by one other user not shown)
Line 2: Line 2:
 
|-
 
|-
 
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> Project name</span>
 
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> Project name</span>
|style="background-color: #F2F2F2" align="center"|<html><img src="/images/9/94/Report.png" border="0" /></html> [[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>[[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]]<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>}}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]]<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>}}
+
|style="background-color: #F2F2F2" align="center"|[[File:Report.png|frameless|link={{#sub:{{FULLPAGENAME}}|0|-11}}]][[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|[[File:Resultset_previous.png|frameless|link={{#lnpreventry:{{FULLPAGENAME}}}}]][[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]]&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;}}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]][[File:Resultset_next.png|frameless|link={{#lnnextentry:{{FULLPAGENAME}}}}]]}}
 
|-
 
|-
 
| colspan="2"|
 
| colspan="2"|
Line 23: Line 23:
  
 
also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers.
 
also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers.
 +
 +
NP primer:
 +
5’-GAG AAA CTG TGC AAAACA G-3’
 +
 +
MP primer:
 +
5’-AGT CAC TAT CAG ATC CGG AA-3’
  
 
Also this page suggests using 1μL of 10μM primer to give final concentration of 0.5μM in 20μL. Maybe I should start running the reactions at 20ul instead.
 
Also this page suggests using 1μL of 10μM primer to give final concentration of 0.5μM in 20μL. Maybe I should start running the reactions at 20ul instead.
Line 31: Line 37:
 
ITS4 5'-TCCTCCGCTTATTGATATGC-3' reverse all
 
ITS4 5'-TCCTCCGCTTATTGATATGC-3' reverse all
  
 
+
'''EDIT THESE PAGES TO SEE NICE FORMATTING'''
 
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
 
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
 
|}
 
|}
  
 
__NOTOC__
 
__NOTOC__

Latest revision as of 21:20, 26 September 2017

Owwnotebook icon.png Project name Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Reconciling information and thoughts after break

I did some reading and thinking and research during the xmas break. This is the result.

Housekeeping Genes

Finally found some housekeeping primers: 18S-F908 18S a AGCGAAAGCATTTGCCAAGA 401 This study (SVB) 18S-R1309 18S a AGTCTCGTTCGTTATCGGAATT This study (SVB)

(from http://wwwnc.cdc.gov/eid/article/11/5/05-0211-t1.htm)

Temps and new primers

P2/P8 primers work best at 60C, confirming my lab work. (from http://www.academia.edu/1460726/Sex_Identification_of_Some_Pet_Birds_by_Polymerase_Chain_Reaction-Based_Methods )

also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers.

NP primer: 5’-GAG AAA CTG TGC AAAACA G-3’

MP primer: 5’-AGT CAC TAT CAG ATC CGG AA-3’

Also this page suggests using 1μL of 10μM primer to give final concentration of 0.5μM in 20μL. Maybe I should start running the reactions at 20ul instead.


Mushy primers: ITS1 5'-TCCGTAGGTGAACCTGCGG-3' forward all ITS4 5'-TCCTCCGCTTATTGATATGC-3' reverse all

EDIT THESE PAGES TO SEE NICE FORMATTING