User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert

From OpenWetWare
< User:S Sibert‎ | Notebook
Revision as of 11:31, 11 April 2013 by S Sibert (talk | contribs) (4/9/13)
Jump to: navigation, search

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext"></div><div style="display:none;" id="page">User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages <html><img src="/images/a/aa/Help.png" border="0" /></html>

SSB13 140L Vanillin synthon - CCOMT-2

  • Assigned Sequence: Stephanie Sibert CCOMT-2 GCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAAGGATGCAGTTTT
    GGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAA
    TAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
    TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTG
    CCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
    397 >Medicago sativa caffeic acid methyltransferase bin 2

Notes

  • Need to use Eco-Bam for digestion
  • Pieces given:

CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC

  • Predicted PCR Product:

ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCAT
GGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTT
AATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGTCATTGA
GGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT


Construction File

PCA CCOMT-2 oligos 1-16, PCA1 Template:SBB-PCA (457, pca1)
PCR pca1 with universalFwd/universalRev, PCA2 (457, pca2)
Digest pca2 with EcoRI/BamHi (changed from BglII), gp (412+26+19 bp, pcr_dig)
(get pre-digested vector from JCA of pBca9145-Bca1144 (EcoRI/BamHI, vect_dig)
Ligate pcr_dig and vect_dig,2469bp, transform, pick white colonies, map, sequence


>Well Position, Name,Sequence >E7, CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
>F7, CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
>G7, CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
>H7, CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
>A8, CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
>B8, CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
>C8, CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
>D8, CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
>E8, CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
>F8, CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
>G8, CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
>H8, CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
>A9, CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
>B9, CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
>C9, CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
>D9, CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC
>A5, universalFwd ATATAGATGCCGTCCTAGC
>B5, universalRev AAGTATCTTTCCTGTGCCCA

>PCA1/2
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAA
TGGAGTCATGGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCAT
GGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACA
GGTTTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAA
GGTATTAATTTTGATTTGCCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGA
AAGATACTT

>final product
GAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAA
GGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAA
GTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGT
CATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCtaaCTCGAGctgcaggcttcctcgctcactgactcgc
tgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaa
gaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacgag
catcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgc
gctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtag
gtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaac
tatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcg
gtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttacctt
cggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcaga
aaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatga
gattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctga
cagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagata
actacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataa
accagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagt
aagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattc
agctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtca
gaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgt
gactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcg
ccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagtt
cgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgc
cgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgt
ctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtct
aagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaa
ggatgatttctg

3/3/12

PCA 1 with contents of CCOMT-2 tube.

3/12/13

Template:SBB-Protocols_Zymo1

Template:SBB-PCA Amplification Step

Digest Eco/Bam

Given to Jon to run program

3/13/13

GEL RUN
This gel is of the PCA2 products for the various synthons. The first lane is the His-tag part's IPCR product (currently unnamed), then molecular weight standards, then the rest are your PCA2's (I couldn't read the labels). All but three look fine. Lanes 4 and 8 look recoverable with a second PCR. The lane 3's reaction needs to be started over from scratch. Lane 7 just needs a careful gel purification.

My sample is the third sample (lane 5)
2013 03 13-JCA-gel1.jpg


3/14/13

Template:SBB-Protocols_Zymo1 Ran gel, cut, melted in zymo buffer. Froze before column step.

3/19/13

Zymo column

3/21/13

ligate [SBB-Protocols_Enz4]
transform
used PCR tubes to fit in incubator.

4/2/13

only 3 colonies in my plate. Only 2 colonies from class had reasonable results.
Run gel on digest from 3/14/13. With Wells at the top, counting from left to right, lane 3. Gel 2.
Set up new digest from pcr products in tube labeled 3/12/13
started incubation at 10:40
removed from incubator 11:40
zymo cleanup column

4/4/13

Ligations 6.5uL ddH2O 1uL Ligation buffer 1uL vector 1uL insert 0.5uL enzyme (last)

Comp Cells 1 tube cells 30uL KCM (no ddH2O)

4/9/13

no colonies in new plate, 3 colonies in old plate will be used to proceed.

picked colonies. by ejecting pipet tip into tube.

4/11/13

1)miniprep culture
2) restriction map EcoRI/XhoI
6ul H2O
1ul buffer
2ul DNA
0.5ul XhoI
0.5ul EcoRI
put in thermo cycler 11:23
3) run a gel
4) Put all juice from 2 good clones in plate to be sent for sequencing.

Recent changes

26 September 2017

     12:48  BME100 f2017:Group8 W1030 L3‎ (diff | hist) . . (+222). . Elizabeth White (talk | contribs) (Descriptive Stats and Graph)

     12:37 

Hoatlin:CONJ606.PMCB How the class works‎‎ (10 changes | history) . . (+708). . [Maureen E. Hoatlin‎ (10×)]

     

12:37

(cur | prev) . . (+3). . Maureen E. Hoatlin (talk | contribs) (Participants in the Class)

     

12:37

(cur | prev) . . (+31). . Maureen E. Hoatlin (talk | contribs) (Participants in the Class)

     

12:35

(cur | prev) . . (0). . Maureen E. Hoatlin (talk | contribs) (Participants in the Class)

     

12:35

(cur | prev) . . (-8). . Maureen E. Hoatlin (talk | contribs) (Participants in the Class)

     

12:34

(cur | prev) . . (-43). . Maureen E. Hoatlin (talk | contribs) (General Class Design)

     

12:32

(cur | prev) . . (+29). . Maureen E. Hoatlin (talk | contribs) (Grades)

     

12:30

(cur | prev) . . (+54). . Maureen E. Hoatlin (talk | contribs) (Participants in the Class)

     

12:30

(cur | prev) . . (+80). . Maureen E. Hoatlin (talk | contribs) (Participants in the Class)

     

12:26

(cur | prev) . . (+2). . Maureen E. Hoatlin (talk | contribs) (Participants in the Class)

     

12:25

(cur | prev) . . (+560). . Maureen E. Hoatlin (talk | contribs) (Participants in the Class)

     12:31 

Li Lab:Publications‎‎ (6 changes | history) . . (+756). . [Wei Li Bcm‎ (6×)]

     

12:31

(cur | prev) . . (+1). . Wei Li Bcm (talk | contribs) (Peer Reviewed Publications)

     

12:19

(cur | prev) . . (+541). . Wei Li Bcm (talk | contribs) (Peer Reviewed Publications)

     

12:11

(cur | prev) . . (-7). . Wei Li Bcm (talk | contribs) (Peer Reviewed Publications)

     

12:10

(cur | prev) . . (+11). . Wei Li Bcm (talk | contribs) (Peer Reviewed Publications)

     

12:09

(cur | prev) . . (+210). . Wei Li Bcm (talk | contribs)

 m   

12:02

(cur | prev) . . (0). . Wei Li Bcm (talk | contribs) (Peer Reviewed Publications)

     12:31 

BME100 f2017:Group7 W0800 L3‎‎ (2 changes | history) . . (+928). . [Wesley Groves‎ (2×)]

     

12:31

(cur | prev) . . (+52). . Wesley Groves (talk | contribs) (Descriptive Stats and Graph)

     

12:16

(cur | prev) . . (+876). . Wesley Groves (talk | contribs) (Design Flaws and Recommendations)

     12:29 

(Upload log). .

[Wesley Groves‎; Pauline Wonnenberg‎; Blake A. McCal‎ (2×)]

     

12:29

. . Wesley Groves (talk | contribs) uploaded File:Screen Shot 2017-09-26 at 12.26.36 PM.png

     

11:43

. . Blake A. McCal (talk | contribs) uploaded File:G3TempScatter.PNG

     

11:40

. . Blake A. McCal (talk | contribs) uploaded File:G3TempBar.PNG

     

11:38

. . Pauline Wonnenberg (talk | contribs) uploaded File:09-06 Titrations Table.png

     12:22 

Li Lab‎‎ (2 changes | history) . . (+278). . [Wei Li Bcm‎ (2×)]

     

12:22

(cur | prev) . . (+118). . Wei Li Bcm (talk | contribs) (Recent News)

     

12:06

(cur | prev) . . (+160). . Wei Li Bcm (talk | contribs) (Recent News)

N    12:06 

BME100 f2017:Group4 W1030 L3‎‎ (3 changes | history) . . (+2,316). . [Quentin S Ellis‎ (3×)]

     

12:06

(cur | prev) . . (+21). . Quentin S Ellis (talk | contribs) (OUR TEAM)

     

12:05

(cur | prev) . . (-169). . Quentin S Ellis (talk | contribs) (LAB 1 WRITE-UP)

N    

12:02

(cur | prev) . . (+2,464). . Quentin S Ellis (talk | contribs) (Created page with "{|{{table}} width="800" |- |style="background-color: #EEE"|128px<span style="font-size:22px;"> BME 100 Fall 2017</span> |style="background-color...")

     12:00 (Deletion log) . . Yar (talk | contribs) deleted page Nbtest(debugging)

     11:58 

BME100 f2017:Group3 W1030 L3‎‎ (16 changes | history) . . (+1,208). . [Blake A. McCal‎ (16×)]

     

11:58

(cur | prev) . . (-31). . Blake A. McCal (talk | contribs) (OUR TEAM)

     

11:52

(cur | prev) . . (+10). . Blake A. McCal (talk | contribs) (Inferential Stats)

     

11:51

(cur | prev) . . (+10). . Blake A. McCal (talk | contribs) (Inferential Stats)

     

11:49

(cur | prev) . . (+6). . Blake A. McCal (talk | contribs) (Descriptive Stats and Graph)

     

11:48

(cur | prev) . . (+12). . Blake A. McCal (talk | contribs) (Descriptive Stats and Graph)

     

11:48

(cur | prev) . . (+6). . Blake A. McCal (talk | contribs) (Descriptive Stats and Graph)

     

11:45

(cur | prev) . . (+22). . Blake A. McCal (talk | contribs) (Descriptive Stats and Graph)

     

11:42

(cur | prev) . . (+32). . Blake A. McCal (talk | contribs) (Descriptive Stats and Graph)

     

11:39

(cur | prev) . . (-7). . Blake A. McCal (talk | contribs) (Descriptive Stats and Graph)

     

11:33

(cur | prev) . . (+31). . Blake A. McCal (talk | contribs) (Descriptive Stats and Graph)

     

11:28

(cur | prev) . . (+725). . Blake A. McCal (talk | contribs) (Design Flaws and Recommendations)

     

11:27

(cur | prev) . . (0). . Blake A. McCal (talk | contribs) (Inferential Stats)

     

11:26

(cur | prev) . . (-1). . Blake A. McCal (talk | contribs) (Inferential Stats)

     

11:26

(cur | prev) . . (+199). . Blake A. McCal (talk | contribs) (Inferential Stats)

     

11:24

(cur | prev) . . (+29). . Blake A. McCal (talk | contribs) (Descriptive Stats and Graph)

     

11:23

(cur | prev) . . (+165). . Blake A. McCal (talk | contribs) (Descriptive Stats and Graph)

     11:40  User:Pauline Wonnenberg/Notebook/CHEM 471 Fall 2017/2017/09/06‎ (diff | hist) . . (+123). . Pauline Wonnenberg (talk | contribs) (Entry title)

     11:27 

BME100 f2017:Group7 W1030 L3‎‎ (2 changes | history) . . (+1,888). . [Sarah R. Brady‎ (2×)]

     

11:27

(cur | prev) . . (+946). . Sarah R. Brady (talk | contribs) (Experimental Design of Own Device)

     

11:10

(cur | prev) . . (+942). . Sarah R. Brady (talk | contribs) (Design Flaws and Recommendations)

     11:02  CAMRI:iLab‎ (diff | hist) . . (-4). . Lacey Berry (talk | contribs) (Problems)
     10:59  Template:CAMRI Navigation Bar‎ (diff | hist) . . (-137). . Michael S Beauchamp (talk | contribs)