User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert

From OpenWetWare
< User:S Sibert‎ | Notebook
Revision as of 09:48, 4 April 2013 by S Sibert (talk | contribs) (4/2/13)
Jump to: navigation, search

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext"></div><div style="display:none;" id="page">User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages <html><img src="/images/a/aa/Help.png" border="0" /></html>

SSB13 140L Vanillin synthon - CCOMT-2

  • Assigned Sequence: Stephanie Sibert CCOMT-2 GCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAAGGATGCAGTTTT
    GGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAA
    TAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
    TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTG
    CCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
    397 >Medicago sativa caffeic acid methyltransferase bin 2

Notes

  • Need to use Eco-Bam for digestion
  • Pieces given:

CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC

  • Predicted PCR Product:

ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCAT
GGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTT
AATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGTCATTGA
GGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT


Construction File

PCA CCOMT-2 oligos 1-16, PCA1 Template:SBB-PCA (457, pca1)
PCR pca1 with universalFwd/universalRev, PCA2 (457, pca2)
Digest pca2 with EcoRI/BamHi (changed from BglII), gp (412+26+19 bp, pcr_dig)
(get pre-digested vector from JCA of pBca9145-Bca1144 (EcoRI/BamHI, vect_dig)
Ligate pcr_dig and vect_dig,2469bp, transform, pick white colonies, map, sequence


>Well Position, Name,Sequence >E7, CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
>F7, CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
>G7, CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
>H7, CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
>A8, CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
>B8, CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
>C8, CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
>D8, CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
>E8, CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
>F8, CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
>G8, CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
>H8, CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
>A9, CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
>B9, CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
>C9, CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
>D9, CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC
>A5, universalFwd ATATAGATGCCGTCCTAGC
>B5, universalRev AAGTATCTTTCCTGTGCCCA

>PCA1/2
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAA
TGGAGTCATGGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCAT
GGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACA
GGTTTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAA
GGTATTAATTTTGATTTGCCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGA
AAGATACTT

>final product
GAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAA
GGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAA
GTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGT
CATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCtaaCTCGAGctgcaggcttcctcgctcactgactcgc
tgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaa
gaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacgag
catcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgc
gctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtag
gtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaac
tatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcg
gtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttacctt
cggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcaga
aaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatga
gattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctga
cagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagata
actacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataa
accagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagt
aagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattc
agctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtca
gaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgt
gactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcg
ccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagtt
cgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgc
cgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgt
ctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtct
aagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaa
ggatgatttctg

3/3/12

PCA 1 with contents of CCOMT-2 tube.

3/12/13

Template:SBB-Protocols_Zymo1

Template:SBB-PCA Amplification Step

Digest Eco/Bam

Given to Jon to run program

3/13/13

GEL RUN
This gel is of the PCA2 products for the various synthons. The first lane is the His-tag part's IPCR product (currently unnamed), then molecular weight standards, then the rest are your PCA2's (I couldn't read the labels). All but three look fine. Lanes 4 and 8 look recoverable with a second PCR. The lane 3's reaction needs to be started over from scratch. Lane 7 just needs a careful gel purification.

My sample is the third sample (lane 5)
2013 03 13-JCA-gel1.jpg


3/14/13

Template:SBB-Protocols_Zymo1 Ran gel, cut, melted in zymo buffer. Froze before column step.

3/19/13

Zymo column

3/21/13

ligate [SBB-Protocols_Enz4]
transform
used PCR tubes to fit in incubator.

4/2/13

only 3 colonies in my plate. Only 2 colonies from class had reasonable results.
Run gel on digest from 3/14/13. With Wells at the top, counting from left to right, lane 3. Gel 2.
Set up new digest from pcr products in tube labeled 3/12/13
started incubation at 10:40
removed from incubator 11:40
zymo cleanup column

4/4/13

Ligations 6.5uL ddH2O 1uL Ligation buffer 1uL vector 1uL insert 0.5uL enzyme (last)

Comp Cells 1 tube cells 30uL KCM (no ddH2O)

Recent changes

18 October 2017

     09:48 

BME100 f2017:Group1 W0800 L4‎‎ (3 changes | history) . . (+26). . [Alexandra Richey‎; Caiden Joseph Gledhill‎ (2×)]

     

09:48

(cur | prev) . . (0). . Caiden Joseph Gledhill (talk | contribs) (OUR TEAM)

     

09:42

(cur | prev) . . (+3). . Caiden Joseph Gledhill (talk | contribs) (OUR TEAM)

     

09:41

(cur | prev) . . (+23). . Alexandra Richey (talk | contribs) (Research and Development)

     09:48 

BME100 f2017:Group7 W1030 L4‎‎ (2 changes | history) . . (+108). . [Sarah R. Brady‎ (2×)]

     

09:48

(cur | prev) . . (0). . Sarah R. Brady (talk | contribs) (Protocol)

     

09:43

(cur | prev) . . (+108). . Sarah R. Brady (talk | contribs) (Protocol)

     09:48 

BME100 f2017:Group5 W0800 L4‎‎ (3 changes | history) . . (+420). . [Anna Hoge‎ (3×)]

     

09:48

(cur | prev) . . (-84). . Anna Hoge (talk | contribs) (OUR TEAM)

     

09:45

(cur | prev) . . (+4). . Anna Hoge (talk | contribs) (OUR TEAM)

     

09:40

(cur | prev) . . (+500). . Anna Hoge (talk | contribs) (Protocol)

     09:48  User:Trevor S. Heaton‎ (diff | hist) . . (-6). . Trevor S. Heaton (talk | contribs)

     09:47 

BME100 f2017:Group6 W0800 L4‎‎ (4 changes | history) . . (+1,390). . [Tajinder Uppal‎ (4×)]

     

09:47

(cur | prev) . . (-1). . Tajinder Uppal (talk | contribs) (SNP Information & Primer Design)

     

09:47

(cur | prev) . . (+2). . Tajinder Uppal (talk | contribs) (SNP Information & Primer Design)

     

09:46

(cur | prev) . . (+389). . Tajinder Uppal (talk | contribs) (Research and Development)

     

09:42

(cur | prev) . . (+1,000). . Tajinder Uppal (talk | contribs) (Research and Development)

     09:47 

BME100 f2017:Group15 W0800 L4‎‎ (5 changes | history) . . (+430). . [Samuel J. Ramirez‎ (2×); John Navas‎ (3×)]

     

09:47

(cur | prev) . . (+337). . Samuel J. Ramirez (talk | contribs) (Part 2: Find the DNA sequence of the SNP, and the surrounding sequence)

     

09:47

(cur | prev) . . (+9). . John Navas (talk | contribs) (OUR TEAM)

     

09:44

(cur | prev) . . (+9). . John Navas (talk | contribs) (OUR TEAM)

     

09:41

(cur | prev) . . (+9). . John Navas (talk | contribs) (OUR TEAM)

     

09:40

(cur | prev) . . (+66). . Samuel J. Ramirez (talk | contribs) (Part 1: Use the NCBI database to find a disease-associated sequence)

     09:47 

(Upload log). .

[Wesley Groves‎; Sayyed Ourmazd Mohseni‎; Carlos Mendez-Arias‎; Anna Hoge‎; Trevor S. Heaton‎ (2×); Alexandra Richey‎ (2×); John Navas‎ (3×); Caiden Joseph Gledhill‎ (3×); Shae M. Diaz‎ (4×)]

     

09:47

. . Trevor S. Heaton (talk | contribs) uploaded File:TSH.JPG

     

09:46

. . Caiden Joseph Gledhill (talk | contribs) uploaded File:Lego scientist 7.jpg

     

09:46

. . John Navas (talk | contribs) uploaded File:BME100WG15 JR PCRsetup.jpg

     

09:45

. . Alexandra Richey (talk | contribs) uploaded a new version of File:AER PCR.jpeg

     

09:44

. . Anna Hoge (talk | contribs) uploaded File:AHavator.jpg

     

09:43

. . Shae M. Diaz (talk | contribs) uploaded a new version of File:BME100Shae.JPG

     

09:43

. . Shae M. Diaz (talk | contribs) uploaded a new version of File:BME100Shae.JPG

     

09:43

. . Caiden Joseph Gledhill (talk | contribs) uploaded File:Lego scientist 3.jpg

     

09:43

. . Shae M. Diaz (talk | contribs) uploaded a new version of File:BME100Shae.JPG

     

09:43

. . Shae M. Diaz (talk | contribs) uploaded a new version of File:BME100Shae.JPG

     

09:43

. . John Navas (talk | contribs) uploaded File:BME100WG15 MK PCRsetup.jpg

     

09:43

. . Wesley Groves (talk | contribs) uploaded File:Wgrovesmoorttyyy.png

     

09:42

. . Alexandra Richey (talk | contribs) uploaded File:AER PCR.jpeg

     

09:42

. . Trevor S. Heaton (talk | contribs) uploaded File:IMG 6508.JPG

     

09:41

. . Sayyed Ourmazd Mohseni (talk | contribs) uploaded File:Rick0.png

     

09:40

. . Caiden Joseph Gledhill (talk | contribs) uploaded File:Lego scientist 2.jpg

     

09:40

. . Carlos Mendez-Arias (talk | contribs) uploaded File:Carlosamendezarias.jpg

     

09:40

. . John Navas (talk | contribs) uploaded File:BME100WG15 SR PCRsetup.jpg

     09:47 

BME100 f2017:Group3 W0800 L4‎‎ (2 changes | history) . . (0). . [Joseph M. Green‎ (2×)]

     

09:47

(cur | prev) . . (0). . Joseph M. Green (talk | contribs) (Research and Development)

     

09:46

(cur | prev) . . (0). . Joseph M. Green (talk | contribs) (Research and Development)

     09:46 

BME100 f2017:Group11 W0800 L4‎‎ (2 changes | history) . . (+307). . [Braeden Malotky‎ (2×)]

     

09:46

(cur | prev) . . (+17). . Braeden Malotky (talk | contribs)

     

09:43

(cur | prev) . . (+290). . Braeden Malotky (talk | contribs)

     09:46  BME100 f2017:Group4 W0800 L4‎ (diff | hist) . . (+30). . Ally M. Coen (talk | contribs) (Protocol)

     09:45 

BME100 f2017:Group9 W0800 L4‎‎ (2 changes | history) . . (+389). . [Renee Chao‎; Erik Sandoval-Ansel‎]

     

09:45

(cur | prev) . . (+319). . Erik Sandoval-Ansel (talk | contribs) (Research and Development)

     

09:45

(cur | prev) . . (+70). . Renee Chao (talk | contribs) (SNP Information & Primer Design)

     09:44 

BME100 f2017:Group7 W0800 L4‎‎ (2 changes | history) . . (-5). . [Wesley Groves‎; Sayyed Ourmazd Mohseni‎]

     

09:44

(cur | prev) . . (+3). . Wesley Groves (talk | contribs) (OUR TEAM)

     

09:42

(cur | prev) . . (-8). . Sayyed Ourmazd Mohseni (talk | contribs) (OUR TEAM)

     09:42  BME100 f2017:Group5 W0800 L3‎ (diff | hist) . . (-1). . Anna Hoge (talk | contribs) (OUR TEAM)

     09:41 

BME100 f2017:Group14 W0800 L4‎‎ (4 changes | history) . . (-195). . [Shae M. Diaz‎; Kennedy Miskin‎; David Leonard E. Asuncion‎ (2×)]

     

09:41

(cur | prev) . . (+38). . David Leonard E. Asuncion (talk | contribs) (Protocol)

     

09:41

(cur | prev) . . (-269). . Kennedy Miskin (talk | contribs) (Research & Development)

     

09:41

(cur | prev) . . (+62). . Shae M. Diaz (talk | contribs) (Protocol)

     

09:40

(cur | prev) . . (-26). . David Leonard E. Asuncion (talk | contribs) (Protocol)