Difference between revisions of "User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert"

From OpenWetWare
Jump to: navigation, search
(Notes)
(3/3/12)
Line 40: Line 40:
 
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCAT<br>GGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTT<br>AATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG<br>TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGTCATTGA<br>GGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT<br><br>
 
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCAT<br>GGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTT<br>AATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG<br>TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGTCATTGA<br>GGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT<br><br>
  
==3/3/12==
+
 
PCA 1 with contents of CCOMT-2 tube.
 
  
 
==Construction File==
 
==Construction File==

Revision as of 09:43, 12 March 2013

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext"></div><div style="display:none;" id="page">User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages <html><img src="/images/a/aa/Help.png" border="0" /></html>

SSB13 140L Vanillin synthon - CCOMT-2

  • Assigned Sequence: Stephanie Sibert CCOMT-2 GCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAAGGATGCAGTTTT
    GGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAA
    TAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
    TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTG
    CCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
    397 >Medicago sativa caffeic acid methyltransferase bin 2

Notes

  • Need to use Eco-Bam for digestion
  • Pieces given:

CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC

  • Predicted PCR Product:

ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCAT
GGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTT
AATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGTCATTGA
GGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT


Construction File

PCA CCOMT-2 oligos 1-16, PCA1 Template:SBB-PCA (457, pca1)
PCR pca1 with universalFwd/universalRev, PCA2 (457, pca2)
Digest pca2 with EcoRI/BamHi (changed from BglII), gp (412+26+19 bp, pcr_dig)
(get pre-digested vector from JCA of pBca9145-Bca1144 (EcoRI/BamHI, vect_dig)
Ligate pcr_dig and vect_dig,2469bp, transform, pick white colonies, map, sequence


>Well Position, Name,Sequence >E7, CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
>F7, CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
>G7, CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
>H7, CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
>A8, CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
>B8, CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
>C8, CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
>D8, CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
>E8, CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
>F8, CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
>G8, CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
>H8, CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
>A9, CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
>B9, CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
>C9, CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
>D9, CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC
>A5, universalFwd ATATAGATGCCGTCCTAGC
>B5, universalRev AAGTATCTTTCCTGTGCCCA

>PCA1/2
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAA
TGGAGTCATGGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCAT
GGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACA
GGTTTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAA
GGTATTAATTTTGATTTGCCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGA
AAGATACTT

>final product
GAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAA
GGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAA
GTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGT
CATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCtaaCTCGAGctgcaggcttcctcgctcactgactcgc
tgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaa
gaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacgag
catcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgc
gctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtag
gtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaac
tatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcg
gtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttacctt
cggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcaga
aaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatga
gattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctga
cagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagata
actacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataa
accagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagt
aagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattc
agctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtca
gaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgt
gactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcg
ccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagtt
cgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgc
cgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgt
ctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtct
aagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaa
ggatgatttctg


Recent changes

16 October 2017

     20:17  User:Kromine‎ (diff | hist) . . (+435). . Kromine (talk | contribs) (Kyle Romine's Discussion Page)

     18:48 

Hoatlin:OHSU Genetic Mechanisms Class‎‎ (2 changes | history) . . (+12). . [Maureen E. Hoatlin‎ (2×)]

     

18:48

(cur | prev) . . (+7). . Maureen E. Hoatlin (talk | contribs) (Other Bonus Material)

     

18:47

(cur | prev) . . (+5). . Maureen E. Hoatlin (talk | contribs) (Other Bonus Material)

N    16:16 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/10/11‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

16:16

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (10/11 Lab Notebook)

N    

16:15

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/10/11 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

     16:15 

(Upload log). .

[Maryam Yamadi‎ (9×)]

     

16:15

. . Maryam Yamadi (talk | contribs) uploaded File:10 11.jpg

     

16:07

. . Maryam Yamadi (talk | contribs) uploaded File:10 10.jpg

     

15:12

. . Maryam Yamadi (talk | contribs) uploaded File:10 04.jpg

     

15:10

. . Maryam Yamadi (talk | contribs) uploaded File:10 03.jpg

     

15:05

. . Maryam Yamadi (talk | contribs) uploaded File:09 27.jpg

     

15:02

. . Maryam Yamadi (talk | contribs) uploaded File:09 26.jpg

     

14:59

. . Maryam Yamadi (talk | contribs) uploaded a new version of File:09 20.jpg(09/20 lab notebook)

     

14:58

. . Maryam Yamadi (talk | contribs) uploaded File:09 20.jpg(09/20 lab notebook)

     

14:55

. . Maryam Yamadi (talk | contribs) uploaded File:09 19.jpg(09_19 lab notebook)

N    16:08 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/10/10‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

16:08

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (10/10 Lab Notebook)

N    

16:06

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/10/10 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

N    15:20 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/10/04‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

15:20

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (10/04 Lab notebook)

N    

15:11

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/10/04 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

N    15:10 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/10/03‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

15:10

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (10/03 Lab Notebook)

N    

15:09

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/10/03 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

N    15:09  User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/10‎ (diff | hist) . . (+202). . Maryam Yamadi (talk | contribs) (Autocreate Month 2017/10 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

N    15:05 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/09/27‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

15:05

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (09/27 Lab Notebook)

N    

15:03

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/09/27 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

N    15:02 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/09/26‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

15:02

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (09/26 Lab notebook)

N    

15:00

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/09/26 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

N    15:00 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/09/20‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

15:00

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (09/20 Lab notebook)

N    

14:57

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/09/20 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

N    14:57 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/09/19‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

14:57

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (09/19 Lab Notebook)

N    

14:56

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/09/19 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

     14:14 

Rich Lab:Important Lab Documents‎‎ (2 changes | history) . . (+1,142). . [Isabel C. Morales‎ (2×)]

     

14:14

(cur | prev) . . (+1). . Isabel C. Morales (talk | contribs)

     

14:12

(cur | prev) . . (+1,141). . Isabel C. Morales (talk | contribs) (Lab Contact List)

     13:27 

CONJ606:Materials‎‎ (2 changes | history) . . (+36). . [Jamesonn‎ (2×)]

     

13:27

(cur | prev) . . (0). . Jamesonn (talk | contribs) (Week 3: TZAP: The Tonsorial Telomere Protein)

     

13:26

(cur | prev) . . (+36). . Jamesonn (talk | contribs) (Week 3:)

     13:17  User:Jamesonn‎ (diff | hist) . . (+27). . Maureen E. Hoatlin (talk | contribs)

     13:16 

CONJ606:People‎‎ (3 changes | history) . . (+259). . [Maureen E. Hoatlin‎; Jamesonn‎ (2×)]

     

13:16

(cur | prev) . . (+69). . Maureen E. Hoatlin (talk | contribs) (Students)

     

13:12

(cur | prev) . . (+8). . Jamesonn (talk | contribs) (Students)

     

13:11

(cur | prev) . . (+182). . Jamesonn (talk | contribs) (Students)

 m   11:32  Swartz‎ (diff | hist) . . (-166). . Julie A. Fogarty (talk | contribs)
     06:33  Lee:JC‎ (diff | hist) . . (+22). . Wooin Lee (talk | contribs) (Lab meeting schedule)

     06:21 

Gao lab:Members‎‎ (2 changes | history) . . (0). . [Xinyu Liu‎ (2×)]

     

06:21

(cur | prev) . . (+9). . Xinyu Liu (talk | contribs) (Alumni)

     

06:20

(cur | prev) . . (-9). . Xinyu Liu (talk | contribs) (Graduate Students)

     01:09  Waldminghaus:Back Door/Lab Seminar‎ (diff | hist) . . (0). . Torsten Waldminghaus (talk | contribs)

15 October 2017

     19:10 

Qin:Publications‎‎ (5 changes | history) . . (+132). . [Zhenpeng Qin‎ (5×)]

     

19:10

(cur | prev) . . (+2). . Zhenpeng Qin (talk | contribs) (Journal Articles)

     

19:04

(cur | prev) . . (0). . Zhenpeng Qin (talk | contribs) (Journal Articles)

     

19:04

(cur | prev) . . (0). . Zhenpeng Qin (talk | contribs) (Journal Articles)

     

19:03

(cur | prev) . . (+53). . Zhenpeng Qin (talk | contribs) (Journal Articles)

     

18:58

(cur | prev) . . (+77). . Zhenpeng Qin (talk | contribs)

     19:09 

(Upload log). .

[Zhenpeng Qin‎ (2×)]

     

19:09

. . Zhenpeng Qin (talk | contribs) uploaded File:Pub.2016.scirep.jpg

     

19:02

. . Zhenpeng Qin (talk | contribs) uploaded File:Pub.2017.ACSSen.gif

     19:00  Qin:Lab Members‎ (diff | hist) . . (-36). . Zhenpeng Qin (talk | contribs)