Difference between revisions of "User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert"

From OpenWetWare
Jump to: navigation, search
(Notes)
(Notes)
Line 20: Line 20:
 
* Need to use Eco-Bam for digestion
 
* Need to use Eco-Bam for digestion
 
* Pieces given:
 
* Pieces given:
CCOMT-2_oligo_1         AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
+
CCOMT-2_oligo_1         AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA <br>
CCOMT-2_oligo_2         AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
+
CCOMT-2_oligo_2         AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC <br>
CCOMT-2_oligo_3         AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
+
CCOMT-2_oligo_3         AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG <br>
CCOMT-2_oligo_4         ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
+
CCOMT-2_oligo_4         ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT <br>
CCOMT-2_oligo_5         ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
+
CCOMT-2_oligo_5         ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT <br>
CCOMT-2_oligo_6         ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
+
CCOMT-2_oligo_6         ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT <br>
CCOMT-2_oligo_7         CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
+
CCOMT-2_oligo_7         CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT <br>
CCOMT-2_oligo_8         CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
+
CCOMT-2_oligo_8         CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT <br>
CCOMT-2_oligo_9         GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
+
CCOMT-2_oligo_9         GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC <br>
CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
+
CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG <br>
CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
+
CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT <br>
CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
+
CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT <br>
CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
+
CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG <br>
CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
+
CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC <br>
CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
+
CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT <br>
CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC
+
CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC <br>
  
  

Revision as of 13:09, 5 March 2013

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext"></div><div style="display:none;" id="page">User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages <html><img src="/images/a/aa/Help.png" border="0" /></html>

SSB13 140L Vanillin synthon - CCOMT-2

  • Assigned Sequence: Stephanie Sibert CCOMT-2 GCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAAGGATGCAGTTTT
    GGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAA
    TAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
    TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTG
    CCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
    397 >Medicago sativa caffeic acid methyltransferase bin 2

Notes

  • Need to use Eco-Bam for digestion
  • Pieces given:

CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC


Recent changes

18 October 2017

     00:09  User:David M.D. Bailey‎ (diff | hist) . . (-37). . David M.D. Bailey (talk | contribs) (Publications)
 m   00:02  Klenow Assembly Method: Seamless cloning‎ (diff | hist) . . (+157). . David M.D. Bailey (talk | contribs) (The Klenow Assembly Method for the seamless cloning of overlapping double stranded DNA fragments: Very cheap alternative to the Gibson Assembly)

17 October 2017

     20:52 

Biomod/2017/StJohns:Results‎‎ (4 changes | history) . . (+1,255). . [Alexkk15‎ (4×)]

     

20:52

(cur | prev) . . (+481). . Alexkk15 (talk | contribs)

     

20:23

(cur | prev) . . (+992). . Alexkk15 (talk | contribs)

     

19:54

(cur | prev) . . (-185). . Alexkk15 (talk | contribs)

     

17:16

(cur | prev) . . (-33). . Alexkk15 (talk | contribs)

     20:50 

Biomod/2017/StJohns:Protocols‎‎ (3 changes | history) . . (+177). . [Alexkk15‎ (3×)]

     

20:50

(cur | prev) . . (+141). . Alexkk15 (talk | contribs)

     

20:46

(cur | prev) . . (+37). . Alexkk15 (talk | contribs) (M)

     

20:40

(cur | prev) . . (-1). . Alexkk15 (talk | contribs) (Forester Resonance Energy Transfer (FRET))

     20:39  Biomod/2017/StJohns‎ (diff | hist) . . (+405). . Alexkk15 (talk | contribs) (XXXNear and Future goalsXXX)
     16:17  McClean:LabMtgSchedule‎ (diff | hist) . . (+30). . Megan N McClean (talk | contribs)
N    15:47  Klenow Assembly Method: Seamless cloning‎ (diff | hist) . . (+4,694). . David M.D. Bailey (talk | contribs) (Created page with " == '''The Klenow Assembly Method for the seamless cloning of overlapping double stranded DNA fragments'''== '''Unpublished: V1, 1-2 David MD Bailey* and Mohamed YH Mohamed...")

     15:32 

User:PosertInLab‎‎ (3 changes | history) . . (+675). . [PosertInLab‎ (3×)]

     

15:32

(cur | prev) . . (+120). . PosertInLab (talk | contribs)

     

15:29

(cur | prev) . . (+28). . PosertInLab (talk | contribs)

     

15:06

(cur | prev) . . (+527). . PosertInLab (talk | contribs)

     15:28  User:David M.D. Bailey‎ (diff | hist) . . (+14). . David M.D. Bailey (talk | contribs) (Contact Info)
     15:12  User:Peteral‎ (diff | hist) . . (+333). . Peteral (talk | contribs) (Alec's Discussion Questions)
     15:04  CONJ606:Discussion‎ (diff | hist) . . (+1). . Weinjule (talk | contribs) (Student Discussion Pages)

     14:56 

User:Jamesonn‎‎ (14 changes | history) . . (+523). . [Jamesonn‎ (14×)]

     

14:56

(cur | prev) . . (-4). . Jamesonn (talk | contribs)

     

14:56

(cur | prev) . . (+4). . Jamesonn (talk | contribs)

     

14:52

(cur | prev) . . (-2). . Jamesonn (talk | contribs)

     

14:52

(cur | prev) . . (+100). . Jamesonn (talk | contribs)

     

14:51

(cur | prev) . . (+83). . Jamesonn (talk | contribs)

     

14:29

(cur | prev) . . (+1). . Jamesonn (talk | contribs)

     

14:27

(cur | prev) . . (+4). . Jamesonn (talk | contribs)

     

14:27

(cur | prev) . . (+41). . Jamesonn (talk | contribs)

     

14:27

(cur | prev) . . (-6). . Jamesonn (talk | contribs)

     

14:26

(cur | prev) . . (+2). . Jamesonn (talk | contribs)

     

14:26

(cur | prev) . . (-1). . Jamesonn (talk | contribs)

     

14:26

(cur | prev) . . (+2). . Jamesonn (talk | contribs)

     

14:25

(cur | prev) . . (+11). . Jamesonn (talk | contribs)

     

14:24

(cur | prev) . . (+288). . Jamesonn (talk | contribs)

     14:31  User:Changx‎ (diff | hist) . . (+1,117). . Changx (talk | contribs) (Xiaolan Chang Discussion Page)

     13:43 

User:Weinjule‎‎ (5 changes | history) . . (+1,335). . [Weinjule‎ (5×)]

     

13:43

(cur | prev) . . (+373). . Weinjule (talk | contribs) (Week 3)

     

13:29

(cur | prev) . . (+1). . Weinjule (talk | contribs) (Week 3)

     

13:29

(cur | prev) . . (+7). . Weinjule (talk | contribs) (Week 3)

     

13:28

(cur | prev) . . (+386). . Weinjule (talk | contribs) (Week 3)

     

13:22

(cur | prev) . . (+568). . Weinjule (talk | contribs) (Discussion Questions)

     13:31 

User:Thorntca‎‎ (3 changes | history) . . (+404). . [Thorntca‎ (3×)]

     

13:31

(cur | prev) . . (+98). . Thorntca (talk | contribs)

     

13:27

(cur | prev) . . (+10). . Thorntca (talk | contribs)

     

13:21

(cur | prev) . . (+296). . Thorntca (talk | contribs)

     13:30 (Upload log) . . Thorntca (talk | contribs) uploaded File:A6003.png

     13:26 

CONJ606:Science in the News‎‎ (2 changes | history) . . (+278). . [Batesti‎ (2×)]

     

13:26

(cur | prev) . . (+6). . Batesti (talk | contribs)

     

13:26

(cur | prev) . . (+272). . Batesti (talk | contribs)

     13:22 

User:Lonelybuffalo‎‎ (3 changes | history) . . (+169). . [Lonelybuffalo‎ (3×)]

     

13:22

(cur | prev) . . (+3). . Lonelybuffalo (talk | contribs) (week 2 October 17 2017 - TZAP: telomere protein)

     

13:21

(cur | prev) . . (+75). . Lonelybuffalo (talk | contribs)

     

13:11

(cur | prev) . . (+91). . Lonelybuffalo (talk | contribs) (week 2 October 17 2017 - TZAP: telomere protein)

     13:19  User:Rollinsr‎ (diff | hist) . . (+167). . Rollinsr (talk | contribs) (TZAP)
     13:14  User:Carusob‎ (diff | hist) . . (+516). . Carusob (talk | contribs) (The Hottest Topics in Science Today: a Graduate Student's Perspective)
     13:12  Deok-Ho Kim‎ (diff | hist) . . (0). . Dhkim21c (talk | contribs)