Difference between revisions of "User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert"

From OpenWetWare
Jump to: navigation, search
(4/19/2012)
(4/23/13)
Line 223: Line 223:
  
 
Transform<br>
 
Transform<br>
Reserve<br>
+
1 tube<br>
 +
20ul KCM<br>
 +
no h20<br>
 +
Rescue <br>
 
plate<br>
 
plate<br>
 +
 +
==4/25/13==
 +
miniprep<br>
 +
map<br>
 +
seq<br>
  
 
|-
 
|-

Revision as of 09:51, 25 April 2013

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext"></div><div style="display:none;" id="page">User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages <html><img src="/images/a/aa/Help.png" border="0" /></html>

SSB13 140L Vanillin synthon - CCOMT-2

  • Assigned Sequence: Stephanie Sibert CCOMT-2 GCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAAGGATGCAGTTTT
    GGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAA
    TAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
    TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTG
    CCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
    397 >Medicago sativa caffeic acid methyltransferase bin 2

Notes

  • Need to use Eco-Bam for digestion
  • Pieces given:

CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC

  • Predicted PCR Product:

ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCAT
GGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTT
AATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGTCATTGA
GGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT


Construction File

PCA CCOMT-2 oligos 1-16, PCA1 Template:SBB-PCA (457, pca1)
PCR pca1 with universalFwd/universalRev, PCA2 (457, pca2)
Digest pca2 with EcoRI/BamHi (changed from BglII), gp (412+26+19 bp, pcr_dig)
(get pre-digested vector from JCA of pBca9145-Bca1144 (EcoRI/BamHI, vect_dig)
Ligate pcr_dig and vect_dig,2469bp, transform, pick white colonies, map, sequence


>Well Position, Name,Sequence >E7, CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
>F7, CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
>G7, CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
>H7, CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
>A8, CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
>B8, CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
>C8, CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
>D8, CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
>E8, CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
>F8, CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
>G8, CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
>H8, CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
>A9, CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
>B9, CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
>C9, CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
>D9, CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC
>A5, universalFwd ATATAGATGCCGTCCTAGC
>B5, universalRev AAGTATCTTTCCTGTGCCCA

>PCA1/2
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAA
TGGAGTCATGGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCAT
GGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACA
GGTTTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAA
GGTATTAATTTTGATTTGCCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGA
AAGATACTT

>final product
GAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAA
GGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAA
GTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGT
CATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCtaaCTCGAGctgcaggcttcctcgctcactgactcgc
tgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaa
gaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacgag
catcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgc
gctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtag
gtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaac
tatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcg
gtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttacctt
cggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcaga
aaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatga
gattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctga
cagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagata
actacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataa
accagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagt
aagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattc
agctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtca
gaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgt
gactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcg
ccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagtt
cgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgc
cgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgt
ctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtct
aagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaa
ggatgatttctg

3/3/12

PCA 1 with contents of CCOMT-2 tube.

3/12/13

Template:SBB-Protocols_Zymo1

Template:SBB-PCA Amplification Step

Digest Eco/Bam

Given to Jon to run program

3/13/13

GEL RUN
This gel is of the PCA2 products for the various synthons. The first lane is the His-tag part's IPCR product (currently unnamed), then molecular weight standards, then the rest are your PCA2's (I couldn't read the labels). All but three look fine. Lanes 4 and 8 look recoverable with a second PCR. The lane 3's reaction needs to be started over from scratch. Lane 7 just needs a careful gel purification.

My sample is the third sample (lane 5)
2013 03 13-JCA-gel1.jpg


3/14/13

Template:SBB-Protocols_Zymo1 Ran gel, cut, melted in zymo buffer. Froze before column step.

3/19/13

Zymo column

3/21/13

ligate [SBB-Protocols_Enz4]
transform
used PCR tubes to fit in incubator.

4/2/13

only 3 colonies in my plate. Only 2 colonies from class had reasonable results.
Run gel on digest from 3/14/13. With Wells at the top, counting from left to right, lane 3. Gel 2.
Set up new digest from pcr products in tube labeled 3/12/13
started incubation at 10:40
removed from incubator 11:40
zymo cleanup column

4/4/13

Ligations 6.5uL ddH2O 1uL Ligation buffer 1uL vector 1uL insert 0.5uL enzyme (last)

Comp Cells 1 tube cells 30uL KCM (no ddH2O)

4/9/13

no colonies in new plate, 3 colonies in old plate will be used to proceed.

picked colonies. by ejecting pipet tip into tube.

4/11/13

1)miniprep culture
2) restriction map EcoRI/XhoI
6ul H2O
1ul buffer
2ul DNA
0.5ul XhoI
0.5ul EcoRI
put in thermo cycler 11:23
3) run a gel
Lane 7-Sample A
Lane 8-Sample B
Lane 9-Sample C

4) No results.

4/16/13

Starting with
50ul rxn
31.5 ul H20
5ul dNTP
10ul Phusion buffer
1ul template (sample from 3/12/13)
1ul 10mm oligo 1 (CCOMT2-3 diluted)
1ul 10mm oligo 2 (CCOMT2-4 diluted)
0.5ul Phusion


Tube placed in thermocycler labeled ccomt2 4/16/13


Golden Gate Set up:
(n)ul ddH2O to 10ul
1ul Ligase Buffer
0.5ul Ligase
0.5ul BsmB1
1ul PER CONSTRUCT
0.5ul vertor

4/18/2013

sample processed by jc anderson to miniprep step
miniprep

4/19/2012

sequence confirmed
golden gate
Protocol:
6.5ul ddH2o
1ul ligase buffer
0.5ul ligase
0.5ul BsMb1
1ul of synthon mic
o.5ul vector

4/23/13

Transform
1 tube
20ul KCM
no h20
Rescue
plate

4/25/13

miniprep
map
seq

Recent changes

17 October 2017

     17:16  Biomod/2017/StJohns:Results‎ (diff | hist) . . (-33). . Alexkk15 (talk | contribs)
     16:17  McClean:LabMtgSchedule‎ (diff | hist) . . (+30). . Megan N McClean (talk | contribs)
N    15:47  Klenow Assembly Method: Seamless cloning‎ (diff | hist) . . (+4,694). . David M.D. Bailey (talk | contribs) (Created page with " == '''The Klenow Assembly Method for the seamless cloning of overlapping double stranded DNA fragments'''== '''Unpublished: V1, 1-2 David MD Bailey* and Mohamed YH Mohamed...")

     15:32 

User:PosertInLab‎‎ (3 changes | history) . . (+675). . [PosertInLab‎ (3×)]

     

15:32

(cur | prev) . . (+120). . PosertInLab (talk | contribs)

     

15:29

(cur | prev) . . (+28). . PosertInLab (talk | contribs)

     

15:06

(cur | prev) . . (+527). . PosertInLab (talk | contribs)

     15:28  User:David M.D. Bailey‎ (diff | hist) . . (+14). . David M.D. Bailey (talk | contribs) (Contact Info)
     15:12  User:Peteral‎ (diff | hist) . . (+333). . Peteral (talk | contribs) (Alec's Discussion Questions)
     15:04  CONJ606:Discussion‎ (diff | hist) . . (+1). . Weinjule (talk | contribs) (Student Discussion Pages)

     14:56 

User:Jamesonn‎‎ (14 changes | history) . . (+523). . [Jamesonn‎ (14×)]

     

14:56

(cur | prev) . . (-4). . Jamesonn (talk | contribs)

     

14:56

(cur | prev) . . (+4). . Jamesonn (talk | contribs)

     

14:52

(cur | prev) . . (-2). . Jamesonn (talk | contribs)

     

14:52

(cur | prev) . . (+100). . Jamesonn (talk | contribs)

     

14:51

(cur | prev) . . (+83). . Jamesonn (talk | contribs)

     

14:29

(cur | prev) . . (+1). . Jamesonn (talk | contribs)

     

14:27

(cur | prev) . . (+4). . Jamesonn (talk | contribs)

     

14:27

(cur | prev) . . (+41). . Jamesonn (talk | contribs)

     

14:27

(cur | prev) . . (-6). . Jamesonn (talk | contribs)

     

14:26

(cur | prev) . . (+2). . Jamesonn (talk | contribs)

     

14:26

(cur | prev) . . (-1). . Jamesonn (talk | contribs)

     

14:26

(cur | prev) . . (+2). . Jamesonn (talk | contribs)

     

14:25

(cur | prev) . . (+11). . Jamesonn (talk | contribs)

     

14:24

(cur | prev) . . (+288). . Jamesonn (talk | contribs)

     14:31  User:Changx‎ (diff | hist) . . (+1,117). . Changx (talk | contribs) (Xiaolan Chang Discussion Page)

     13:43 

User:Weinjule‎‎ (5 changes | history) . . (+1,335). . [Weinjule‎ (5×)]

     

13:43

(cur | prev) . . (+373). . Weinjule (talk | contribs) (Week 3)

     

13:29

(cur | prev) . . (+1). . Weinjule (talk | contribs) (Week 3)

     

13:29

(cur | prev) . . (+7). . Weinjule (talk | contribs) (Week 3)

     

13:28

(cur | prev) . . (+386). . Weinjule (talk | contribs) (Week 3)

     

13:22

(cur | prev) . . (+568). . Weinjule (talk | contribs) (Discussion Questions)

     13:31 

User:Thorntca‎‎ (3 changes | history) . . (+404). . [Thorntca‎ (3×)]

     

13:31

(cur | prev) . . (+98). . Thorntca (talk | contribs)

     

13:27

(cur | prev) . . (+10). . Thorntca (talk | contribs)

     

13:21

(cur | prev) . . (+296). . Thorntca (talk | contribs)

     13:30 

(Upload log). .

[Thorntca‎; Mackenzie K. Kelley‎ (2×)]

     

13:30

. . Thorntca (talk | contribs) uploaded File:A6003.png

     

12:50

. . Mackenzie K. Kelley (talk | contribs) uploaded File:Screen Shot 2017-10-17 at 3.44.08 PM.png

     

12:48

. . Mackenzie K. Kelley (talk | contribs) uploaded File:Screen Shot 2017-10-17 at 3.43.48 PM.png

     13:26 

CONJ606:Science in the News‎‎ (2 changes | history) . . (+278). . [Batesti‎ (2×)]

     

13:26

(cur | prev) . . (+6). . Batesti (talk | contribs)

     

13:26

(cur | prev) . . (+272). . Batesti (talk | contribs)

     13:22 

User:Lonelybuffalo‎‎ (3 changes | history) . . (+169). . [Lonelybuffalo‎ (3×)]

     

13:22

(cur | prev) . . (+3). . Lonelybuffalo (talk | contribs) (week 2 October 17 2017 - TZAP: telomere protein)

     

13:21

(cur | prev) . . (+75). . Lonelybuffalo (talk | contribs)

     

13:11

(cur | prev) . . (+91). . Lonelybuffalo (talk | contribs) (week 2 October 17 2017 - TZAP: telomere protein)

     13:19  User:Rollinsr‎ (diff | hist) . . (+167). . Rollinsr (talk | contribs) (TZAP)
     13:14  User:Carusob‎ (diff | hist) . . (+516). . Carusob (talk | contribs) (The Hottest Topics in Science Today: a Graduate Student's Perspective)
     13:12  Deok-Ho Kim‎ (diff | hist) . . (0). . Dhkim21c (talk | contribs)

     13:05 

User:Dominique Brager/Notebook/481 Notebook/2017/09/13‎‎ (2 changes | history) . . (-1). . [Dominique Brager‎ (2×)]

     

13:05

(cur | prev) . . (-1). . Dominique Brager (talk | contribs) (Data)

     

13:05

(cur | prev) . . (0). . Dominique Brager (talk | contribs) (Data)

     12:59 

User:Batesti‎‎ (2 changes | history) . . (+1,085). . [Batesti‎ (2×)]

     

12:59

(cur | prev) . . (+18). . Batesti (talk | contribs)

     

12:56

(cur | prev) . . (+1,067). . Batesti (talk | contribs)

     12:51 

User:Mackenzie K. Kelley/Notebook/Experimental Biochemistry/2017/09/27‎‎ (3 changes | history) . . (+151). . [Mackenzie K. Kelley‎ (3×)]

     

12:51

(cur | prev) . . (+100). . Mackenzie K. Kelley (talk | contribs) (Results)

     

12:47

(cur | prev) . . (+50). . Mackenzie K. Kelley (talk | contribs) (Results)

     

12:45

(cur | prev) . . (+1). . Mackenzie K. Kelley (talk | contribs) (Results)