Difference between revisions of "User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert"

From OpenWetWare
Jump to: navigation, search
(4/11/13)
(4/25/13)
(11 intermediate revisions by the same user not shown)
Line 182: Line 182:
  
 
==4/16/13==
 
==4/16/13==
Starting with sample from 3/12/13
+
Starting with <br>
50ul rxn
+
50ul rxn<br>
31.5 ul H20
+
31.5 ul H20<br>
5ul dNTP
+
5ul dNTP<br>
10ul Phusion buffer
+
10ul Phusion buffer<br>
1ul template
+
1ul template (sample from 3/12/13)<br>
1ul 10mm oligo 1
+
1ul 10mm oligo 1 (CCOMT2-3 diluted)<br>
1ul 10mm oligo 2
+
1ul 10mm oligo 2 (CCOMT2-4 diluted)<br>
0.5ul Phusion
+
0.5ul Phusion<br>
 +
 
 +
 
 +
Tube placed in thermocycler labeled ccomt2 4/16/13
 +
 
 +
 
 +
 
 +
Golden Gate Set up:<br>
 +
(n)ul ddH2O to 10ul<br>
 +
1ul Ligase Buffer<br>
 +
0.5ul Ligase<br>
 +
0.5ul BsmB1<br>
 +
1ul PER CONSTRUCT<br>
 +
0.5ul vertor<br>
 +
 
 +
==4/18/2013==
 +
sample processed by jc anderson to miniprep step <br>
 +
miniprep<br>
 +
 
 +
==4/19/2012==
 +
sequence confirmed<br>
 +
golden gate<br>
 +
Protocol:<br>
 +
6.5ul ddH2o<br>
 +
1ul ligase buffer<br>
 +
0.5ul ligase<br>
 +
0.5ul BsMb1<br>
 +
1ul of synthon mic<br>
 +
o.5ul vector<br>
 +
 
 +
==4/23/13==
 +
 
 +
Transform<br>
 +
1 tube<br>
 +
20ul KCM<br>
 +
no h20<br>
 +
Rescue <br>
 +
plate<br>
 +
 
 +
==4/25/13==
 +
~miniprep~<br>
 +
6.5ul H20<br>
 +
2ul Plasmid<br>
 +
1ul NEB2<br>
 +
0.5ul Bsa1<br>
 +
<Br>
 +
~map~<br>
 +
lanes 7,8,9 <br>
 +
A,B,D respectivly<br>
 +
 
 +
 
 +
 
 +
 
 +
~seq~<br>
  
 
|-
 
|-

Revision as of 11:54, 25 April 2013

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext"></div><div style="display:none;" id="page">User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages <html><img src="/images/a/aa/Help.png" border="0" /></html>

SSB13 140L Vanillin synthon - CCOMT-2

  • Assigned Sequence: Stephanie Sibert CCOMT-2 GCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAAGGATGCAGTTTT
    GGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAA
    TAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
    TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTG
    CCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
    397 >Medicago sativa caffeic acid methyltransferase bin 2

Notes

  • Need to use Eco-Bam for digestion
  • Pieces given:

CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC

  • Predicted PCR Product:

ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCAT
GGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTT
AATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGTCATTGA
GGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT


Construction File

PCA CCOMT-2 oligos 1-16, PCA1 Template:SBB-PCA (457, pca1)
PCR pca1 with universalFwd/universalRev, PCA2 (457, pca2)
Digest pca2 with EcoRI/BamHi (changed from BglII), gp (412+26+19 bp, pcr_dig)
(get pre-digested vector from JCA of pBca9145-Bca1144 (EcoRI/BamHI, vect_dig)
Ligate pcr_dig and vect_dig,2469bp, transform, pick white colonies, map, sequence


>Well Position, Name,Sequence >E7, CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
>F7, CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
>G7, CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
>H7, CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
>A8, CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
>B8, CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
>C8, CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
>D8, CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
>E8, CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
>F8, CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
>G8, CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
>H8, CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
>A9, CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
>B9, CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
>C9, CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
>D9, CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC
>A5, universalFwd ATATAGATGCCGTCCTAGC
>B5, universalRev AAGTATCTTTCCTGTGCCCA

>PCA1/2
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAA
TGGAGTCATGGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCAT
GGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACA
GGTTTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAA
GGTATTAATTTTGATTTGCCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGA
AAGATACTT

>final product
GAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAA
GGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAA
GTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGT
CATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCtaaCTCGAGctgcaggcttcctcgctcactgactcgc
tgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaa
gaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacgag
catcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgc
gctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtag
gtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaac
tatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcg
gtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttacctt
cggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcaga
aaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatga
gattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctga
cagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagata
actacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataa
accagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagt
aagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattc
agctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtca
gaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgt
gactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcg
ccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagtt
cgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgc
cgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgt
ctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtct
aagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaa
ggatgatttctg

3/3/12

PCA 1 with contents of CCOMT-2 tube.

3/12/13

Template:SBB-Protocols_Zymo1

Template:SBB-PCA Amplification Step

Digest Eco/Bam

Given to Jon to run program

3/13/13

GEL RUN
This gel is of the PCA2 products for the various synthons. The first lane is the His-tag part's IPCR product (currently unnamed), then molecular weight standards, then the rest are your PCA2's (I couldn't read the labels). All but three look fine. Lanes 4 and 8 look recoverable with a second PCR. The lane 3's reaction needs to be started over from scratch. Lane 7 just needs a careful gel purification.

My sample is the third sample (lane 5)
2013 03 13-JCA-gel1.jpg


3/14/13

Template:SBB-Protocols_Zymo1 Ran gel, cut, melted in zymo buffer. Froze before column step.

3/19/13

Zymo column

3/21/13

ligate [SBB-Protocols_Enz4]
transform
used PCR tubes to fit in incubator.

4/2/13

only 3 colonies in my plate. Only 2 colonies from class had reasonable results.
Run gel on digest from 3/14/13. With Wells at the top, counting from left to right, lane 3. Gel 2.
Set up new digest from pcr products in tube labeled 3/12/13
started incubation at 10:40
removed from incubator 11:40
zymo cleanup column

4/4/13

Ligations 6.5uL ddH2O 1uL Ligation buffer 1uL vector 1uL insert 0.5uL enzyme (last)

Comp Cells 1 tube cells 30uL KCM (no ddH2O)

4/9/13

no colonies in new plate, 3 colonies in old plate will be used to proceed.

picked colonies. by ejecting pipet tip into tube.

4/11/13

1)miniprep culture
2) restriction map EcoRI/XhoI
6ul H2O
1ul buffer
2ul DNA
0.5ul XhoI
0.5ul EcoRI
put in thermo cycler 11:23
3) run a gel
Lane 7-Sample A
Lane 8-Sample B
Lane 9-Sample C

4) No results.

4/16/13

Starting with
50ul rxn
31.5 ul H20
5ul dNTP
10ul Phusion buffer
1ul template (sample from 3/12/13)
1ul 10mm oligo 1 (CCOMT2-3 diluted)
1ul 10mm oligo 2 (CCOMT2-4 diluted)
0.5ul Phusion


Tube placed in thermocycler labeled ccomt2 4/16/13


Golden Gate Set up:
(n)ul ddH2O to 10ul
1ul Ligase Buffer
0.5ul Ligase
0.5ul BsmB1
1ul PER CONSTRUCT
0.5ul vertor

4/18/2013

sample processed by jc anderson to miniprep step
miniprep

4/19/2012

sequence confirmed
golden gate
Protocol:
6.5ul ddH2o
1ul ligase buffer
0.5ul ligase
0.5ul BsMb1
1ul of synthon mic
o.5ul vector

4/23/13

Transform
1 tube
20ul KCM
no h20
Rescue
plate

4/25/13

~miniprep~
6.5ul H20
2ul Plasmid
1ul NEB2
0.5ul Bsa1

~map~
lanes 7,8,9
A,B,D respectivly



~seq~

Recent changes

26 September 2017

     15:45  OpenWetWare:Contact‎ (diff | hist) . . (-1,087). . Yar (talk | contribs) (use the form)
     15:44  OpenWetWare:How to join‎ (diff | hist) . . (-5,644). . Yar (talk | contribs) (it's a new era)

     15:41 

CONJ606:Schedule‎‎ (2 changes | history) . . (+10). . [Maureen E. Hoatlin‎ (2×)]

     

15:41

(cur | prev) . . (0). . Maureen E. Hoatlin (talk | contribs) (Week-by-Week Schedule Summary)

     

15:40

(cur | prev) . . (+10). . Maureen E. Hoatlin (talk | contribs) (Week-by-Week Schedule Summary)

     15:40 

(User creation log). .

[Yar‎ (3×)]

     

15:40

. . User account Kimercer (talk | contribs) was created by Yar (talk | contribs) and password was sent by email ‎

     

15:40

. . User account Guzmanga (talk | contribs) was created by Yar (talk | contribs) and password was sent by email ‎

     

15:40

. . User account Weinjule (talk | contribs) was created by Yar (talk | contribs) and password was sent by email ‎

     15:28 

User:Pauline Wonnenberg/Notebook/CHEM 471 Fall 2017/2017/09/06‎‎ (2 changes | history) . . (+188). . [Pauline Wonnenberg‎ (2×)]

     

15:28

(cur | prev) . . (+183). . Pauline Wonnenberg (talk | contribs)

     

14:00

(cur | prev) . . (+5). . Pauline Wonnenberg (talk | contribs)

     15:27 

(Upload log). .

[Sarah R. Brady‎ (4×); Pauline Wonnenberg‎ (4×)]

     

15:27

. . Pauline Wonnenberg (talk | contribs) uploaded File:Titration 3 Graph.png

     

14:11

. . Sarah R. Brady (talk | contribs) uploaded File:Heart rate with asterisk.jpg

     

14:03

. . Pauline Wonnenberg (talk | contribs) uploaded a new version of File:Titration 2 Graph.png

     

14:03

. . Pauline Wonnenberg (talk | contribs) uploaded File:Titration 2 Graph.png

     

14:02

. . Sarah R. Brady (talk | contribs) uploaded File:Temp with asterisk.jpg

     

14:01

. . Pauline Wonnenberg (talk | contribs) uploaded File:Titration 1 Graph.png

     

13:54

. . Sarah R. Brady (talk | contribs) uploaded File:Temp bme 100.jpg(temp bme 100 group 7)

     

13:54

. . Sarah R. Brady (talk | contribs) uploaded a new version of File:Temp.jpg(temp bme 100 group 7)

     15:21  BioMicroCenter:BioinfoClasses‎ (diff | hist) . . (+64). . Vincent L. Butty (talk | contribs)

     14:42 

BME100 f2017:Group7 W1030 L3‎‎ (12 changes | history) . . (+321). . [Sarah R. Brady‎ (12×)]

     

14:42

(cur | prev) . . (+243). . Sarah R. Brady (talk | contribs) (Experimental Design of Own Device)

     

14:39

(cur | prev) . . (+226). . Sarah R. Brady (talk | contribs) (Experimental Design of Own Device)

     

14:35

(cur | prev) . . (+21). . Sarah R. Brady (talk | contribs) (Design Flaws and Recommendations)

     

14:32

(cur | prev) . . (+36). . Sarah R. Brady (talk | contribs) (Experimental Design of Own Device)

     

14:25

(cur | prev) . . (+20). . Sarah R. Brady (talk | contribs) (Descriptive Stats)

     

14:24

(cur | prev) . . (+82). . Sarah R. Brady (talk | contribs) (Experimental Design of Own Device)

     

14:16

(cur | prev) . . (-270). . Sarah R. Brady (talk | contribs) (Design Flaws and Recommendations)

     

14:12

(cur | prev) . . (-17). . Sarah R. Brady (talk | contribs) (Heart Rate Average)

     

14:04

(cur | prev) . . (-1). . Sarah R. Brady (talk | contribs) (Temperature Average)

     

14:04

(cur | prev) . . (-25). . Sarah R. Brady (talk | contribs) (Inferential Stats)

     

14:00

(cur | prev) . . (+2). . Sarah R. Brady (talk | contribs) (Inferential Stats)

     

13:53

(cur | prev) . . (+4). . Sarah R. Brady (talk | contribs) (Heart Rate Data Discussion)

 m   14:12  Talk:Butlin:Unix for Bioinformatics - advanced tutorial‎ (diff | hist) . . (-183). . Claudius E Kerth (talk | contribs)

     14:10 

Butlin:Unix for Bioinformatics - advanced tutorial‎‎ (3 changes | history) . . (+648). . [Claudius E Kerth‎ (3×)]

 m   

14:10

(cur | prev) . . (-158). . Claudius E Kerth (talk | contribs) (/* TASK 12: I need to run programme X that requires 2 input files and cannot read compressed files. My input files are very large and disk space is always precious. How can I avoid first having to uncompress my input files and later recompress them whe...)

     

14:10

(cur | prev) . . (+804). . Claudius E Kerth (talk | contribs) (Added blurb to endnote, with link to Arnie's speech)

 m   

13:49

(cur | prev) . . (+2). . Claudius E Kerth (talk | contribs) (Notes)

     13:51 

Li Lab‎‎ (7 changes | history) . . (+3,624). . [Wei Li Bcm‎ (7×)]

     

13:51

(cur | prev) . . (+1). . Wei Li Bcm (talk | contribs)

     

13:49

(cur | prev) . . (-39). . Wei Li Bcm (talk | contribs)

     

13:48

(cur | prev) . . (-342). . Wei Li Bcm (talk | contribs)

     

13:47

(cur | prev) . . (-104). . Wei Li Bcm (talk | contribs)

     

13:45

(cur | prev) . . (+4). . Wei Li Bcm (talk | contribs)

     

13:44

(cur | prev) . . (+3,825). . Wei Li Bcm (talk | contribs)

     

13:42

(cur | prev) . . (+279). . Wei Li Bcm (talk | contribs)

     13:44 

Butlin:Unix for Bioinformatics - basic tutorial‎‎ (2 changes | history) . . (+961). . [Claudius E Kerth‎ (2×)]

     

13:44

(cur | prev) . . (0). . Claudius E Kerth (talk | contribs) (put definition of Unix to the front)

     

13:40

(cur | prev) . . (+961). . Claudius E Kerth (talk | contribs) (Added appeal not to copy-paste command lines)

     13:35 

Taylor:Publications‎‎ (3 changes | history) . . (+371). . [Lynne S. Taylor‎ (3×)]

     

13:35

(cur | prev) . . (+316). . Lynne S. Taylor (talk | contribs) (PUBLICATIONS)

     

13:31

(cur | prev) . . (-3). . Lynne S. Taylor (talk | contribs) (PUBLICATIONS)

     

13:30

(cur | prev) . . (+58). . Lynne S. Taylor (talk | contribs) (PUBLICATIONS)

     13:35  BME100 f2017:Group15 W1030 L3‎ (diff | hist) . . (+3). . Kylie I. Mercer (talk | contribs) (OUR TEAM)

     13:33 

BME100 f2017:Group9 W0800 L3‎‎ (2 changes | history) . . (+2,192). . [Irene Zhang‎ (2×)]

     

13:33

(cur | prev) . . (+1,582). . Irene Zhang (talk | contribs) (Design Flaws and Recommendations)

     

13:29

(cur | prev) . . (+610). . Irene Zhang (talk | contribs) (Inferential Stats)

     13:29  BME100 f2017:Group5 W0800 L3‎ (diff | hist) . . (+160). . Anna Hoge (talk | contribs) (Inferential Stats and Analysis)