Difference between revisions of "User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert"

From OpenWetWare
Jump to: navigation, search
(3/12/13)
(4/25/13)
(31 intermediate revisions by the same user not shown)
Line 114: Line 114:
 
[[Template:SBB-Protocols_Zymo1]]<br>
 
[[Template:SBB-Protocols_Zymo1]]<br>
  
[[Template:SBB-Protocols_PCR2]]
+
[[Template:SBB-PCA]] Amplification Step<br>
 +
 
 +
Digest Eco/Bam
 +
 
 +
Given to Jon to run program
  
 
==3/13/13==
 
==3/13/13==
GEL RUN
+
GEL RUN<br>
My sample is lane 3<br>[[Image:2013_03_13-JCA-gel1.jpg]]
+
This gel is of the PCA2 products for the various synthons. The first lane is the His-tag part's IPCR product (currently unnamed), then molecular weight standards, then the rest are your PCA2's (I couldn't read the labels). All but three look fine. Lanes 4 and 8 look recoverable with a second PCR. The lane 3's reaction needs to be started over from scratch. Lane 7 just needs a careful gel purification.<br>
 +
 
 +
My sample is the third sample (lane 5)<br>[[Image:2013_03_13-JCA-gel1.jpg]]
 +
 
 +
 
 +
==3/14/13==
 +
[[Template:SBB-Protocols_Zymo1]]
 +
Ran gel, cut, melted in zymo buffer. Froze before column step.
 +
 
 +
==3/19/13==
 +
Zymo column
 +
 
 +
==3/21/13==
 +
ligate [SBB-Protocols_Enz4]<br>
 +
transform<br>
 +
used PCR tubes to fit in incubator.
 +
 
 +
==4/2/13==
 +
only 3 colonies in my plate. Only 2 colonies from class had reasonable results. <br>
 +
Run gel on digest from 3/14/13. With Wells at the top, counting from left to right, lane 3. Gel 2. <br>
 +
Set up new digest from pcr products in tube labeled 3/12/13<br>
 +
started incubation at 10:40<br>
 +
removed from incubator 11:40<br>
 +
zymo cleanup column<br>
 +
 
 +
==4/4/13==
 +
Ligations
 +
6.5uL ddH2O
 +
1uL Ligation buffer
 +
1uL vector
 +
1uL insert
 +
0.5uL enzyme (last)
 +
 
 +
Comp Cells
 +
1 tube cells
 +
30uL KCM
 +
(no ddH2O)
 +
 
 +
==4/9/13==
 +
no colonies in new plate, 3 colonies in old plate will be used to proceed.
 +
 
 +
picked colonies. by ejecting pipet tip into tube.
 +
 
 +
==4/11/13==
 +
1)miniprep culture<br>
 +
2) restriction map EcoRI/XhoI<br>
 +
6ul H2O<br>
 +
1ul buffer<br>
 +
2ul DNA<br>
 +
0.5ul XhoI<br>
 +
0.5ul EcoRI<br>
 +
put in thermo cycler 11:23<br>
 +
3) run a gel<br>
 +
Lane 7-Sample A<br>
 +
Lane 8-Sample B<br>
 +
Lane 9-Sample C<br>
 +
 
 +
4) No results.<br>
 +
 
 +
==4/16/13==
 +
Starting with <br>
 +
50ul rxn<br>
 +
31.5 ul H20<br>
 +
5ul dNTP<br>
 +
10ul Phusion buffer<br>
 +
1ul template (sample from 3/12/13)<br>
 +
1ul 10mm oligo 1 (CCOMT2-3 diluted)<br>
 +
1ul 10mm oligo 2 (CCOMT2-4 diluted)<br>
 +
0.5ul Phusion<br>
 +
 
 +
 
 +
Tube placed in thermocycler labeled ccomt2 4/16/13
 +
 
 +
 
 +
 
 +
Golden Gate Set up:<br>
 +
(n)ul ddH2O to 10ul<br>
 +
1ul Ligase Buffer<br>
 +
0.5ul Ligase<br>
 +
0.5ul BsmB1<br>
 +
1ul PER CONSTRUCT<br>
 +
0.5ul vertor<br>
 +
 
 +
==4/18/2013==
 +
sample processed by jc anderson to miniprep step <br>
 +
miniprep<br>
 +
 
 +
==4/19/2012==
 +
sequence confirmed<br>
 +
golden gate<br>
 +
Protocol:<br>
 +
6.5ul ddH2o<br>
 +
1ul ligase buffer<br>
 +
0.5ul ligase<br>
 +
0.5ul BsMb1<br>
 +
1ul of synthon mic<br>
 +
o.5ul vector<br>
 +
 
 +
==4/23/13==
 +
 
 +
Transform<br>
 +
1 tube<br>
 +
20ul KCM<br>
 +
no h20<br>
 +
Rescue <br>
 +
plate<br>
 +
 
 +
==4/25/13==
 +
~miniprep~<br>
 +
6.5ul H20<br>
 +
2ul Plasmid<br>
 +
1ul NEB2<br>
 +
0.5ul Bsa1<br>
 +
<Br>
 +
~map~<br>
 +
lanes 7,8,9 <br>
 +
A,B,D respectivly<br>
 +
 
 +
 
 +
 
 +
 
 +
~seq~<br>
  
 
|-
 
|-

Revision as of 11:54, 25 April 2013

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext"></div><div style="display:none;" id="page">User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages <html><img src="/images/a/aa/Help.png" border="0" /></html>

SSB13 140L Vanillin synthon - CCOMT-2

  • Assigned Sequence: Stephanie Sibert CCOMT-2 GCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAAGGATGCAGTTTT
    GGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAA
    TAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
    TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTG
    CCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
    397 >Medicago sativa caffeic acid methyltransferase bin 2

Notes

  • Need to use Eco-Bam for digestion
  • Pieces given:

CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC

  • Predicted PCR Product:

ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCAT
GGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTT
AATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGTCATTGA
GGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT


Construction File

PCA CCOMT-2 oligos 1-16, PCA1 Template:SBB-PCA (457, pca1)
PCR pca1 with universalFwd/universalRev, PCA2 (457, pca2)
Digest pca2 with EcoRI/BamHi (changed from BglII), gp (412+26+19 bp, pcr_dig)
(get pre-digested vector from JCA of pBca9145-Bca1144 (EcoRI/BamHI, vect_dig)
Ligate pcr_dig and vect_dig,2469bp, transform, pick white colonies, map, sequence


>Well Position, Name,Sequence >E7, CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
>F7, CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
>G7, CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
>H7, CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
>A8, CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
>B8, CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
>C8, CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
>D8, CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
>E8, CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
>F8, CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
>G8, CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
>H8, CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
>A9, CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
>B9, CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
>C9, CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
>D9, CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC
>A5, universalFwd ATATAGATGCCGTCCTAGC
>B5, universalRev AAGTATCTTTCCTGTGCCCA

>PCA1/2
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAA
TGGAGTCATGGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCAT
GGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACA
GGTTTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAA
GGTATTAATTTTGATTTGCCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGA
AAGATACTT

>final product
GAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAA
GGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAA
GTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGT
CATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCtaaCTCGAGctgcaggcttcctcgctcactgactcgc
tgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaa
gaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacgag
catcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgc
gctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtag
gtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaac
tatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcg
gtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttacctt
cggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcaga
aaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatga
gattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctga
cagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagata
actacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataa
accagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagt
aagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattc
agctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtca
gaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgt
gactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcg
ccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagtt
cgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgc
cgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgt
ctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtct
aagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaa
ggatgatttctg

3/3/12

PCA 1 with contents of CCOMT-2 tube.

3/12/13

Template:SBB-Protocols_Zymo1

Template:SBB-PCA Amplification Step

Digest Eco/Bam

Given to Jon to run program

3/13/13

GEL RUN
This gel is of the PCA2 products for the various synthons. The first lane is the His-tag part's IPCR product (currently unnamed), then molecular weight standards, then the rest are your PCA2's (I couldn't read the labels). All but three look fine. Lanes 4 and 8 look recoverable with a second PCR. The lane 3's reaction needs to be started over from scratch. Lane 7 just needs a careful gel purification.

My sample is the third sample (lane 5)
2013 03 13-JCA-gel1.jpg


3/14/13

Template:SBB-Protocols_Zymo1 Ran gel, cut, melted in zymo buffer. Froze before column step.

3/19/13

Zymo column

3/21/13

ligate [SBB-Protocols_Enz4]
transform
used PCR tubes to fit in incubator.

4/2/13

only 3 colonies in my plate. Only 2 colonies from class had reasonable results.
Run gel on digest from 3/14/13. With Wells at the top, counting from left to right, lane 3. Gel 2.
Set up new digest from pcr products in tube labeled 3/12/13
started incubation at 10:40
removed from incubator 11:40
zymo cleanup column

4/4/13

Ligations 6.5uL ddH2O 1uL Ligation buffer 1uL vector 1uL insert 0.5uL enzyme (last)

Comp Cells 1 tube cells 30uL KCM (no ddH2O)

4/9/13

no colonies in new plate, 3 colonies in old plate will be used to proceed.

picked colonies. by ejecting pipet tip into tube.

4/11/13

1)miniprep culture
2) restriction map EcoRI/XhoI
6ul H2O
1ul buffer
2ul DNA
0.5ul XhoI
0.5ul EcoRI
put in thermo cycler 11:23
3) run a gel
Lane 7-Sample A
Lane 8-Sample B
Lane 9-Sample C

4) No results.

4/16/13

Starting with
50ul rxn
31.5 ul H20
5ul dNTP
10ul Phusion buffer
1ul template (sample from 3/12/13)
1ul 10mm oligo 1 (CCOMT2-3 diluted)
1ul 10mm oligo 2 (CCOMT2-4 diluted)
0.5ul Phusion


Tube placed in thermocycler labeled ccomt2 4/16/13


Golden Gate Set up:
(n)ul ddH2O to 10ul
1ul Ligase Buffer
0.5ul Ligase
0.5ul BsmB1
1ul PER CONSTRUCT
0.5ul vertor

4/18/2013

sample processed by jc anderson to miniprep step
miniprep

4/19/2012

sequence confirmed
golden gate
Protocol:
6.5ul ddH2o
1ul ligase buffer
0.5ul ligase
0.5ul BsMb1
1ul of synthon mic
o.5ul vector

4/23/13

Transform
1 tube
20ul KCM
no h20
Rescue
plate

4/25/13

~miniprep~
6.5ul H20
2ul Plasmid
1ul NEB2
0.5ul Bsa1

~map~
lanes 7,8,9
A,B,D respectivly



~seq~

Recent changes

19 October 2017

     21:07  BME100 f2017:Group7 W0800 L4‎ (diff | hist) . . (+977). . Miguel R. Almanza Lopez (talk | contribs) (SNP Information & Primer Design)

     18:43 

BME100 f2017:Group6 W1030 L4‎‎ (4 changes | history) . . (+1,447). . [Ray Gerard Regorgo‎ (4×)]

     

18:43

(cur | prev) . . (-196). . Ray Gerard Regorgo (talk | contribs) (OUR TEAM)

     

18:42

(cur | prev) . . (-3). . Ray Gerard Regorgo (talk | contribs) (OUR TEAM)

     

17:59

(cur | prev) . . (-3). . Ray Gerard Regorgo (talk | contribs) (Research and Development)

     

16:46

(cur | prev) . . (+1,649). . Ray Gerard Regorgo (talk | contribs) (Research and Development)

     15:43  User:Julie A. Fogarty‎ (diff | hist) . . (+46). . Julie A. Fogarty (talk | contribs) (Julie A. Fogarty)

     15:33 

Rich Lab:Funding‎‎ (2 changes | history) . . (-12). . [Isabel C. Morales‎ (2×)]

     

15:33

(cur | prev) . . (+12). . Isabel C. Morales (talk | contribs)

     

14:06

(cur | prev) . . (-24). . Isabel C. Morales (talk | contribs)

     14:58 

CONJ606:Materials‎‎ (2 changes | history) . . (+1,004). . [Weinjule‎; Peteral‎]

     

14:58

(cur | prev) . . (+685). . Peteral (talk | contribs) (Week 2: Me Myself and I-dentifiers, The Key To Immortality (Persistence))

     

12:15

(cur | prev) . . (+319). . Weinjule (talk | contribs) (Papers)

     14:52 

User:Peteral‎‎ (3 changes | history) . . (+1,264). . [Peteral‎ (3×)]

     

14:52

(cur | prev) . . (+185). . Peteral (talk | contribs) (Alec's Discussion Questions)

     

13:52

(cur | prev) . . (+351). . Peteral (talk | contribs) (Alec's Discussion Questions)

     

10:53

(cur | prev) . . (+728). . Peteral (talk | contribs) (Alec's Discussion Questions)

     14:13 

BME100 f2017:Group14 W0800 L4‎‎ (9 changes | history) . . (+9). . [Shae M. Diaz‎ (9×)]

     

14:13

(cur | prev) . . (+8). . Shae M. Diaz (talk | contribs) (Protocol)

     

14:12

(cur | prev) . . (-31). . Shae M. Diaz (talk | contribs) (TEAM MEMBERS)

     

14:10

(cur | prev) . . (+31). . Shae M. Diaz (talk | contribs) (TEAM MEMBERS)

     

14:09

(cur | prev) . . (+4). . Shae M. Diaz (talk | contribs) (TEAM MEMBERS)

     

14:05

(cur | prev) . . (-1). . Shae M. Diaz (talk | contribs) (TEAM MEMBERS)

     

14:05

(cur | prev) . . (+1). . Shae M. Diaz (talk | contribs) (TEAM MEMBERS)

     

14:04

(cur | prev) . . (-1). . Shae M. Diaz (talk | contribs) (TEAM MEMBERS)

     

13:55

(cur | prev) . . (+1). . Shae M. Diaz (talk | contribs) (TEAM MEMBERS)

     

13:55

(cur | prev) . . (-3). . Shae M. Diaz (talk | contribs) (TEAM MEMBERS)

 m   14:12  Swartz‎ (diff | hist) . . (+61). . Marcus Rohovie (talk | contribs)
     14:10 (Move log) . . Marcus Rohovie (talk | contribs) moved page Swartz to Swartz:Main

     14:08 

(Upload log). .

[Thorntca‎; Shae M. Diaz‎ (3×)]

     

14:08

. . Shae M. Diaz (talk | contribs) uploaded File:100profileshae.JPG

     

14:01

. . Shae M. Diaz (talk | contribs) uploaded File:Shaediaz100.JPG

     

13:51

. . Shae M. Diaz (talk | contribs) uploaded File:BME100ShaeD.JPG

     

13:17

. . Thorntca (talk | contribs) uploaded File:2Dgel.png.jpg

     13:52 

Klenow Assembly Method: Seamless cloning‎‎ (3 changes | history) . . (+101). . [David M.D. Bailey‎ (3×)]

     

13:52

(cur | prev) . . (-5). . David M.D. Bailey (talk | contribs) (The Klenow Assembly Method (KAM) for the seamless cloning of overlapping double stranded DNA fragments: Very cheap alternative to the Gibson Assembly)

     

13:51

(cur | prev) . . (+1). . David M.D. Bailey (talk | contribs) (The Klenow Assembly Method (KAM) for the seamless cloning of overlapping double stranded DNA fragments: Very cheap alternative to the Gibson Assembly)

     

13:50

(cur | prev) . . (+105). . David M.D. Bailey (talk | contribs) (The Klenow Assembly Method (KAM) for the seamless cloning of overlapping double stranded DNA fragments: Very cheap alternative to the Gibson Assembly)

     13:22 

User:Thorntca‎‎ (8 changes | history) . . (+529). . [Thorntca‎ (8×)]

     

13:22

(cur | prev) . . (+145). . Thorntca (talk | contribs)

     

13:19

(cur | prev) . . (+17). . Thorntca (talk | contribs)

     

13:19

(cur | prev) . . (+4). . Thorntca (talk | contribs)

     

13:18

(cur | prev) . . (+30). . Thorntca (talk | contribs)

     

13:16

(cur | prev) . . (+417). . Thorntca (talk | contribs)

     

12:52

(cur | prev) . . (+12). . Thorntca (talk | contribs)

     

12:51

(cur | prev) . . (-5). . Thorntca (talk | contribs)

     

12:51

(cur | prev) . . (-91). . Thorntca (talk | contribs)

     12:27 

User:Madeline.churchill‎‎ (2 changes | history) . . (+302). . [Madeline.churchill‎ (2×)]

     

12:27

(cur | prev) . . (0). . Madeline.churchill (talk | contribs) (TZAP protein controls telomere Trimming process)

     

12:27

(cur | prev) . . (+302). . Madeline.churchill (talk | contribs) (Madeline Churchill's Discussion Page)

     09:17  BioMicroCenter:BIG meeting‎ (diff | hist) . . (+19). . George W Bell (talk | contribs) (2017-2018 academic year)
     07:06 (User creation log) . . User account Newfish (talk | contribs) was created by Yar (talk | contribs) and password was sent by email ‎

     04:10 

BioMicroCenter:BioinfoClasses‎‎ (3 changes | history) . . (+132). . [Charlie Whittaker‎ (3×)]

     

04:10

(cur | prev) . . (+9). . Charlie Whittaker (talk | contribs) (Teaching Schedule)

     

04:09

(cur | prev) . . (0). . Charlie Whittaker (talk | contribs) (Teaching Schedule)

     

04:08

(cur | prev) . . (+123). . Charlie Whittaker (talk | contribs) (Teaching Schedule)

     03:36  User:Timothee Flutre‎ (diff | hist) . . (+146). . Timothee Flutre (talk | contribs) (add contrib breedR and SO)

 m   02:27 

How to write a research paper‎‎ (2 changes | history) . . (+91). . [Formand‎ (2×)]

 m   

02:27

(cur | prev) . . (-1). . Formand (talk | contribs) (External links)

 m   

02:24

(cur | prev) . . (+92). . Formand (talk | contribs) (External links)

18 October 2017

     19:09  BME100 f2017:Group10 W0800 L4‎ (diff | hist) . . (+1). . Osvaldo J Pagan (talk | contribs)