Difference between revisions of "User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert"

From OpenWetWare
Jump to: navigation, search
(Construction File)
(4/25/13)
(35 intermediate revisions by the same user not shown)
Line 110: Line 110:
 
==3/3/12==
 
==3/3/12==
 
PCA 1 with contents of CCOMT-2 tube.
 
PCA 1 with contents of CCOMT-2 tube.
 +
 +
==3/12/13==
 +
[[Template:SBB-Protocols_Zymo1]]<br>
 +
 +
[[Template:SBB-PCA]] Amplification Step<br>
 +
 +
Digest Eco/Bam
 +
 +
Given to Jon to run program
 +
 +
==3/13/13==
 +
GEL RUN<br>
 +
This gel is of the PCA2 products for the various synthons. The first lane is the His-tag part's IPCR product (currently unnamed), then molecular weight standards, then the rest are your PCA2's (I couldn't read the labels). All but three look fine. Lanes 4 and 8 look recoverable with a second PCR. The lane 3's reaction needs to be started over from scratch. Lane 7 just needs a careful gel purification.<br>
 +
 +
My sample is the third sample (lane 5)<br>[[Image:2013_03_13-JCA-gel1.jpg]]
 +
 +
 +
==3/14/13==
 +
[[Template:SBB-Protocols_Zymo1]]
 +
Ran gel, cut, melted in zymo buffer. Froze before column step.
 +
 +
==3/19/13==
 +
Zymo column
 +
 +
==3/21/13==
 +
ligate [SBB-Protocols_Enz4]<br>
 +
transform<br>
 +
used PCR tubes to fit in incubator.
 +
 +
==4/2/13==
 +
only 3 colonies in my plate. Only 2 colonies from class had reasonable results. <br>
 +
Run gel on digest from 3/14/13. With Wells at the top, counting from left to right, lane 3. Gel 2. <br>
 +
Set up new digest from pcr products in tube labeled 3/12/13<br>
 +
started incubation at 10:40<br>
 +
removed from incubator 11:40<br>
 +
zymo cleanup column<br>
 +
 +
==4/4/13==
 +
Ligations
 +
6.5uL ddH2O
 +
1uL Ligation buffer
 +
1uL vector
 +
1uL insert
 +
0.5uL enzyme (last)
 +
 +
Comp Cells
 +
1 tube cells
 +
30uL KCM
 +
(no ddH2O)
 +
 +
==4/9/13==
 +
no colonies in new plate, 3 colonies in old plate will be used to proceed.
 +
 +
picked colonies. by ejecting pipet tip into tube.
 +
 +
==4/11/13==
 +
1)miniprep culture<br>
 +
2) restriction map EcoRI/XhoI<br>
 +
6ul H2O<br>
 +
1ul buffer<br>
 +
2ul DNA<br>
 +
0.5ul XhoI<br>
 +
0.5ul EcoRI<br>
 +
put in thermo cycler 11:23<br>
 +
3) run a gel<br>
 +
Lane 7-Sample A<br>
 +
Lane 8-Sample B<br>
 +
Lane 9-Sample C<br>
 +
 +
4) No results.<br>
 +
 +
==4/16/13==
 +
Starting with <br>
 +
50ul rxn<br>
 +
31.5 ul H20<br>
 +
5ul dNTP<br>
 +
10ul Phusion buffer<br>
 +
1ul template (sample from 3/12/13)<br>
 +
1ul 10mm oligo 1 (CCOMT2-3 diluted)<br>
 +
1ul 10mm oligo 2 (CCOMT2-4 diluted)<br>
 +
0.5ul Phusion<br>
 +
 +
 +
Tube placed in thermocycler labeled ccomt2 4/16/13
 +
 +
 +
 +
Golden Gate Set up:<br>
 +
(n)ul ddH2O to 10ul<br>
 +
1ul Ligase Buffer<br>
 +
0.5ul Ligase<br>
 +
0.5ul BsmB1<br>
 +
1ul PER CONSTRUCT<br>
 +
0.5ul vertor<br>
 +
 +
==4/18/2013==
 +
sample processed by jc anderson to miniprep step <br>
 +
miniprep<br>
 +
 +
==4/19/2012==
 +
sequence confirmed<br>
 +
golden gate<br>
 +
Protocol:<br>
 +
6.5ul ddH2o<br>
 +
1ul ligase buffer<br>
 +
0.5ul ligase<br>
 +
0.5ul BsMb1<br>
 +
1ul of synthon mic<br>
 +
o.5ul vector<br>
 +
 +
==4/23/13==
 +
 +
Transform<br>
 +
1 tube<br>
 +
20ul KCM<br>
 +
no h20<br>
 +
Rescue <br>
 +
plate<br>
 +
 +
==4/25/13==
 +
~miniprep~<br>
 +
6.5ul H20<br>
 +
2ul Plasmid<br>
 +
1ul NEB2<br>
 +
0.5ul Bsa1<br>
 +
<Br>
 +
~map~<br>
 +
lanes 7,8,9 <br>
 +
A,B,D respectivly<br>
 +
 +
 +
 +
 +
~seq~<br>
  
 
|-
 
|-

Revision as of 11:54, 25 April 2013

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext"></div><div style="display:none;" id="page">User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages <html><img src="/images/a/aa/Help.png" border="0" /></html>

SSB13 140L Vanillin synthon - CCOMT-2

  • Assigned Sequence: Stephanie Sibert CCOMT-2 GCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAAGGATGCAGTTTT
    GGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAA
    TAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
    TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTG
    CCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
    397 >Medicago sativa caffeic acid methyltransferase bin 2

Notes

  • Need to use Eco-Bam for digestion
  • Pieces given:

CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC

  • Predicted PCR Product:

ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCAT
GGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTT
AATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGTCATTGA
GGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT


Construction File

PCA CCOMT-2 oligos 1-16, PCA1 Template:SBB-PCA (457, pca1)
PCR pca1 with universalFwd/universalRev, PCA2 (457, pca2)
Digest pca2 with EcoRI/BamHi (changed from BglII), gp (412+26+19 bp, pcr_dig)
(get pre-digested vector from JCA of pBca9145-Bca1144 (EcoRI/BamHI, vect_dig)
Ligate pcr_dig and vect_dig,2469bp, transform, pick white colonies, map, sequence


>Well Position, Name,Sequence >E7, CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
>F7, CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
>G7, CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
>H7, CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
>A8, CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
>B8, CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
>C8, CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
>D8, CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
>E8, CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
>F8, CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
>G8, CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
>H8, CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
>A9, CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
>B9, CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
>C9, CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
>D9, CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC
>A5, universalFwd ATATAGATGCCGTCCTAGC
>B5, universalRev AAGTATCTTTCCTGTGCCCA

>PCA1/2
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAA
TGGAGTCATGGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCAT
GGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACA
GGTTTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAA
GGTATTAATTTTGATTTGCCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGA
AAGATACTT

>final product
GAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAA
GGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAA
GTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGT
CATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCtaaCTCGAGctgcaggcttcctcgctcactgactcgc
tgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaa
gaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacgag
catcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgc
gctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtag
gtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaac
tatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcg
gtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttacctt
cggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcaga
aaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatga
gattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctga
cagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagata
actacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataa
accagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagt
aagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattc
agctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtca
gaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgt
gactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcg
ccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagtt
cgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgc
cgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgt
ctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtct
aagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaa
ggatgatttctg

3/3/12

PCA 1 with contents of CCOMT-2 tube.

3/12/13

Template:SBB-Protocols_Zymo1

Template:SBB-PCA Amplification Step

Digest Eco/Bam

Given to Jon to run program

3/13/13

GEL RUN
This gel is of the PCA2 products for the various synthons. The first lane is the His-tag part's IPCR product (currently unnamed), then molecular weight standards, then the rest are your PCA2's (I couldn't read the labels). All but three look fine. Lanes 4 and 8 look recoverable with a second PCR. The lane 3's reaction needs to be started over from scratch. Lane 7 just needs a careful gel purification.

My sample is the third sample (lane 5)
2013 03 13-JCA-gel1.jpg


3/14/13

Template:SBB-Protocols_Zymo1 Ran gel, cut, melted in zymo buffer. Froze before column step.

3/19/13

Zymo column

3/21/13

ligate [SBB-Protocols_Enz4]
transform
used PCR tubes to fit in incubator.

4/2/13

only 3 colonies in my plate. Only 2 colonies from class had reasonable results.
Run gel on digest from 3/14/13. With Wells at the top, counting from left to right, lane 3. Gel 2.
Set up new digest from pcr products in tube labeled 3/12/13
started incubation at 10:40
removed from incubator 11:40
zymo cleanup column

4/4/13

Ligations 6.5uL ddH2O 1uL Ligation buffer 1uL vector 1uL insert 0.5uL enzyme (last)

Comp Cells 1 tube cells 30uL KCM (no ddH2O)

4/9/13

no colonies in new plate, 3 colonies in old plate will be used to proceed.

picked colonies. by ejecting pipet tip into tube.

4/11/13

1)miniprep culture
2) restriction map EcoRI/XhoI
6ul H2O
1ul buffer
2ul DNA
0.5ul XhoI
0.5ul EcoRI
put in thermo cycler 11:23
3) run a gel
Lane 7-Sample A
Lane 8-Sample B
Lane 9-Sample C

4) No results.

4/16/13

Starting with
50ul rxn
31.5 ul H20
5ul dNTP
10ul Phusion buffer
1ul template (sample from 3/12/13)
1ul 10mm oligo 1 (CCOMT2-3 diluted)
1ul 10mm oligo 2 (CCOMT2-4 diluted)
0.5ul Phusion


Tube placed in thermocycler labeled ccomt2 4/16/13


Golden Gate Set up:
(n)ul ddH2O to 10ul
1ul Ligase Buffer
0.5ul Ligase
0.5ul BsmB1
1ul PER CONSTRUCT
0.5ul vertor

4/18/2013

sample processed by jc anderson to miniprep step
miniprep

4/19/2012

sequence confirmed
golden gate
Protocol:
6.5ul ddH2o
1ul ligase buffer
0.5ul ligase
0.5ul BsMb1
1ul of synthon mic
o.5ul vector

4/23/13

Transform
1 tube
20ul KCM
no h20
Rescue
plate

4/25/13

~miniprep~
6.5ul H20
2ul Plasmid
1ul NEB2
0.5ul Bsa1

~map~
lanes 7,8,9
A,B,D respectivly



~seq~

Recent changes

16 October 2017

     20:17  User:Kromine‎ (diff | hist) . . (+435). . Kromine (talk | contribs) (Kyle Romine's Discussion Page)

     18:48 

Hoatlin:OHSU Genetic Mechanisms Class‎‎ (2 changes | history) . . (+12). . [Maureen E. Hoatlin‎ (2×)]

     

18:48

(cur | prev) . . (+7). . Maureen E. Hoatlin (talk | contribs) (Other Bonus Material)

     

18:47

(cur | prev) . . (+5). . Maureen E. Hoatlin (talk | contribs) (Other Bonus Material)

N    16:16 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/10/11‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

16:16

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (10/11 Lab Notebook)

N    

16:15

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/10/11 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

     16:15 

(Upload log). .

[Maryam Yamadi‎ (9×)]

     

16:15

. . Maryam Yamadi (talk | contribs) uploaded File:10 11.jpg

     

16:07

. . Maryam Yamadi (talk | contribs) uploaded File:10 10.jpg

     

15:12

. . Maryam Yamadi (talk | contribs) uploaded File:10 04.jpg

     

15:10

. . Maryam Yamadi (talk | contribs) uploaded File:10 03.jpg

     

15:05

. . Maryam Yamadi (talk | contribs) uploaded File:09 27.jpg

     

15:02

. . Maryam Yamadi (talk | contribs) uploaded File:09 26.jpg

     

14:59

. . Maryam Yamadi (talk | contribs) uploaded a new version of File:09 20.jpg(09/20 lab notebook)

     

14:58

. . Maryam Yamadi (talk | contribs) uploaded File:09 20.jpg(09/20 lab notebook)

     

14:55

. . Maryam Yamadi (talk | contribs) uploaded File:09 19.jpg(09_19 lab notebook)

N    16:08 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/10/10‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

16:08

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (10/10 Lab Notebook)

N    

16:06

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/10/10 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

N    15:20 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/10/04‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

15:20

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (10/04 Lab notebook)

N    

15:11

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/10/04 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

N    15:10 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/10/03‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

15:10

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (10/03 Lab Notebook)

N    

15:09

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/10/03 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

N    15:09  User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/10‎ (diff | hist) . . (+202). . Maryam Yamadi (talk | contribs) (Autocreate Month 2017/10 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

N    15:05 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/09/27‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

15:05

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (09/27 Lab Notebook)

N    

15:03

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/09/27 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

N    15:02 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/09/26‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

15:02

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (09/26 Lab notebook)

N    

15:00

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/09/26 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

N    15:00 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/09/20‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

15:00

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (09/20 Lab notebook)

N    

14:57

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/09/20 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

N    14:57 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/09/19‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

14:57

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (09/19 Lab Notebook)

N    

14:56

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/09/19 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

     14:14 

Rich Lab:Important Lab Documents‎‎ (2 changes | history) . . (+1,142). . [Isabel C. Morales‎ (2×)]

     

14:14

(cur | prev) . . (+1). . Isabel C. Morales (talk | contribs)

     

14:12

(cur | prev) . . (+1,141). . Isabel C. Morales (talk | contribs) (Lab Contact List)

     13:27 

CONJ606:Materials‎‎ (2 changes | history) . . (+36). . [Jamesonn‎ (2×)]

     

13:27

(cur | prev) . . (0). . Jamesonn (talk | contribs) (Week 3: TZAP: The Tonsorial Telomere Protein)

     

13:26

(cur | prev) . . (+36). . Jamesonn (talk | contribs) (Week 3:)

     13:17  User:Jamesonn‎ (diff | hist) . . (+27). . Maureen E. Hoatlin (talk | contribs)

     13:16 

CONJ606:People‎‎ (3 changes | history) . . (+259). . [Maureen E. Hoatlin‎; Jamesonn‎ (2×)]

     

13:16

(cur | prev) . . (+69). . Maureen E. Hoatlin (talk | contribs) (Students)

     

13:12

(cur | prev) . . (+8). . Jamesonn (talk | contribs) (Students)

     

13:11

(cur | prev) . . (+182). . Jamesonn (talk | contribs) (Students)

 m   11:32  Swartz‎ (diff | hist) . . (-166). . Julie A. Fogarty (talk | contribs)
     06:33  Lee:JC‎ (diff | hist) . . (+22). . Wooin Lee (talk | contribs) (Lab meeting schedule)

     06:21 

Gao lab:Members‎‎ (2 changes | history) . . (0). . [Xinyu Liu‎ (2×)]

     

06:21

(cur | prev) . . (+9). . Xinyu Liu (talk | contribs) (Alumni)

     

06:20

(cur | prev) . . (-9). . Xinyu Liu (talk | contribs) (Graduate Students)

     01:09  Waldminghaus:Back Door/Lab Seminar‎ (diff | hist) . . (0). . Torsten Waldminghaus (talk | contribs)

15 October 2017

     19:10 

Qin:Publications‎‎ (5 changes | history) . . (+132). . [Zhenpeng Qin‎ (5×)]

     

19:10

(cur | prev) . . (+2). . Zhenpeng Qin (talk | contribs) (Journal Articles)

     

19:04

(cur | prev) . . (0). . Zhenpeng Qin (talk | contribs) (Journal Articles)

     

19:04

(cur | prev) . . (0). . Zhenpeng Qin (talk | contribs) (Journal Articles)

     

19:03

(cur | prev) . . (+53). . Zhenpeng Qin (talk | contribs) (Journal Articles)

     

18:58

(cur | prev) . . (+77). . Zhenpeng Qin (talk | contribs)

     19:09 

(Upload log). .

[Zhenpeng Qin‎ (2×)]

     

19:09

. . Zhenpeng Qin (talk | contribs) uploaded File:Pub.2016.scirep.jpg

     

19:02

. . Zhenpeng Qin (talk | contribs) uploaded File:Pub.2017.ACSSen.gif

     19:00  Qin:Lab Members‎ (diff | hist) . . (-36). . Zhenpeng Qin (talk | contribs)