User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert

From OpenWetWare
< User:S Sibert‎ | Notebook
Revision as of 11:58, 11 April 2013 by S Sibert (talk | contribs) (4/11/13)
Jump to: navigation, search

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext"></div><div style="display:none;" id="page">User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages <html><img src="/images/a/aa/Help.png" border="0" /></html>

SSB13 140L Vanillin synthon - CCOMT-2

  • Assigned Sequence: Stephanie Sibert CCOMT-2 GCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAAGGATGCAGTTTT
    GGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAA
    TAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
    TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTG
    CCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
    397 >Medicago sativa caffeic acid methyltransferase bin 2

Notes

  • Need to use Eco-Bam for digestion
  • Pieces given:

CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC

  • Predicted PCR Product:

ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCAT
GGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTT
AATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGTCATTGA
GGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT


Construction File

PCA CCOMT-2 oligos 1-16, PCA1 Template:SBB-PCA (457, pca1)
PCR pca1 with universalFwd/universalRev, PCA2 (457, pca2)
Digest pca2 with EcoRI/BamHi (changed from BglII), gp (412+26+19 bp, pcr_dig)
(get pre-digested vector from JCA of pBca9145-Bca1144 (EcoRI/BamHI, vect_dig)
Ligate pcr_dig and vect_dig,2469bp, transform, pick white colonies, map, sequence


>Well Position, Name,Sequence >E7, CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
>F7, CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
>G7, CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
>H7, CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
>A8, CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
>B8, CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
>C8, CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
>D8, CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
>E8, CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
>F8, CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
>G8, CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
>H8, CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
>A9, CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
>B9, CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
>C9, CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
>D9, CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC
>A5, universalFwd ATATAGATGCCGTCCTAGC
>B5, universalRev AAGTATCTTTCCTGTGCCCA

>PCA1/2
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAA
TGGAGTCATGGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCAT
GGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACA
GGTTTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAA
GGTATTAATTTTGATTTGCCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGA
AAGATACTT

>final product
GAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAA
GGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAA
GTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGT
CATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCtaaCTCGAGctgcaggcttcctcgctcactgactcgc
tgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaa
gaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacgag
catcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgc
gctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtag
gtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaac
tatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcg
gtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttacctt
cggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcaga
aaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatga
gattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctga
cagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagata
actacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataa
accagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagt
aagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattc
agctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtca
gaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgt
gactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcg
ccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagtt
cgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgc
cgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgt
ctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtct
aagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaa
ggatgatttctg

3/3/12

PCA 1 with contents of CCOMT-2 tube.

3/12/13

Template:SBB-Protocols_Zymo1

Template:SBB-PCA Amplification Step

Digest Eco/Bam

Given to Jon to run program

3/13/13

GEL RUN
This gel is of the PCA2 products for the various synthons. The first lane is the His-tag part's IPCR product (currently unnamed), then molecular weight standards, then the rest are your PCA2's (I couldn't read the labels). All but three look fine. Lanes 4 and 8 look recoverable with a second PCR. The lane 3's reaction needs to be started over from scratch. Lane 7 just needs a careful gel purification.

My sample is the third sample (lane 5)
2013 03 13-JCA-gel1.jpg


3/14/13

Template:SBB-Protocols_Zymo1 Ran gel, cut, melted in zymo buffer. Froze before column step.

3/19/13

Zymo column

3/21/13

ligate [SBB-Protocols_Enz4]
transform
used PCR tubes to fit in incubator.

4/2/13

only 3 colonies in my plate. Only 2 colonies from class had reasonable results.
Run gel on digest from 3/14/13. With Wells at the top, counting from left to right, lane 3. Gel 2.
Set up new digest from pcr products in tube labeled 3/12/13
started incubation at 10:40
removed from incubator 11:40
zymo cleanup column

4/4/13

Ligations 6.5uL ddH2O 1uL Ligation buffer 1uL vector 1uL insert 0.5uL enzyme (last)

Comp Cells 1 tube cells 30uL KCM (no ddH2O)

4/9/13

no colonies in new plate, 3 colonies in old plate will be used to proceed.

picked colonies. by ejecting pipet tip into tube.

4/11/13

1)miniprep culture
2) restriction map EcoRI/XhoI
6ul H2O
1ul buffer
2ul DNA
0.5ul XhoI
0.5ul EcoRI
put in thermo cycler 11:23
3) run a gel
Lane 7-Sample A
Lane 8-Sample B
Lane 9-Sample C

4) Put all juice from 2 good clones in plate to be sent for sequencing.

Recent changes

26 September 2017

     07:32 

Tomlinson:News‎‎ (2 changes | history) . . (+83). . [Ryan E. Tomlinson‎ (2×)]

     

07:32

(cur | prev) . . (+11). . Ryan E. Tomlinson (talk | contribs) (2017)

     

07:32

(cur | prev) . . (+72). . Ryan E. Tomlinson (talk | contribs)

     07:30 

Tomlinson:Lab Members‎‎ (3 changes | history) . . (+46). . [Ryan E. Tomlinson‎ (3×)]

     

07:30

(cur | prev) . . (+4). . Ryan E. Tomlinson (talk | contribs) (Kimberly Huang)

     

07:30

(cur | prev) . . (+4). . Ryan E. Tomlinson (talk | contribs) (Emily Rumpf)

     

07:30

(cur | prev) . . (+38). . Ryan E. Tomlinson (talk | contribs)

     07:11 (Move log) . . Karmella Haynes (talk | contribs) moved page BME100 f2017:Group6 W1030 L6 to BME100 f2017:Group6 W1030 L6 delete this page(Class assignment. Students did not follow instructions for generating a page with correct formatting. Freeing up the page title to allow students to re-generate the correct page.)
     07:07  BME100 f2017:Projects6‎ (diff | hist) . . (+19). . Karmella Haynes (talk | contribs)
     07:07  BME100 f2017:Projects5‎ (diff | hist) . . (+19). . Karmella Haynes (talk | contribs)
     07:07  BME100 f2017:Projects4‎ (diff | hist) . . (+19). . Karmella Haynes (talk | contribs)
     07:01  BME100 f2017:Projects3‎ (diff | hist) . . (+19). . Karmella Haynes (talk | contribs)
     06:59  BME100 f2017:Projects2‎ (diff | hist) . . (+19). . Karmella Haynes (talk | contribs)

     04:06 

Butlin:Unix for Bioinformatics - advanced tutorial‎‎ (3 changes | history) . . (+334). . [Claudius E Kerth‎ (3×)]

     

04:06

(cur | prev) . . (+148). . Claudius E Kerth (talk | contribs) (Added troublehooting tip: when rename.pl download link does not work, go to my Dropbox)

     

02:44

(cur | prev) . . (+168). . Claudius E Kerth (talk | contribs) (added Troubleshooting tip)

 m   

02:36

(cur | prev) . . (+18). . Claudius E Kerth (talk | contribs) (TASK 5: I have split my reads by barcode and I have quality filtered them. Now I want to know how many reads I have left from each (barcoded) individual. How can I find that out?)

25 September 2017

     21:19 

BME100 f2017:Group12 W0800 L3‎‎ (12 changes | history) . . (+3,361). . [Priscilla Y. Han‎ (12×)]

     

21:19

(cur | prev) . . (+25). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     

21:15

(cur | prev) . . (+70). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     

21:11

(cur | prev) . . (-3). . Priscilla Y. Han (talk | contribs) (Experimental Design of Device)

     

21:10

(cur | prev) . . (-12). . Priscilla Y. Han (talk | contribs) (Experimental Design of Device)

     

21:10

(cur | prev) . . (+15). . Priscilla Y. Han (talk | contribs) (Experimental Design of Device)

     

21:09

(cur | prev) . . (+3,181). . Priscilla Y. Han (talk | contribs) (Experimental Design of Device)

     

21:05

(cur | prev) . . (+5). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     

21:03

(cur | prev) . . (+25). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     

21:01

(cur | prev) . . (+2). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     

20:58

(cur | prev) . . (+29). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     

20:57

(cur | prev) . . (-3). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     

20:55

(cur | prev) . . (+27). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     21:19 

(Upload log). .

[Priscilla Y. Han‎ (7×)]

     

21:19

. . Priscilla Y. Han (talk | contribs) uploaded File:Pulsingbargraph12.png

     

21:18

. . Priscilla Y. Han (talk | contribs) uploaded File:Mypear sonheart12.png

     

21:18

. . Priscilla Y. Han (talk | contribs) uploaded File:Heartratespree12.png

     

21:04

. . Priscilla Y. Han (talk | contribs) uploaded File:Scrnshotspree12.png

     

20:59

. . Priscilla Y. Han (talk | contribs) uploaded File:2columnbarsspree.png

     

20:56

. . Priscilla Y. Han (talk | contribs) uploaded a new version of File:Mypear sonr.png

     

20:56

. . Priscilla Y. Han (talk | contribs) uploaded File:Mypear sonr.png

     20:33 

BME100 f2017:Group8 W1030 L3‎‎ (9 changes | history) . . (+501). . [Jennifer L. Brodsky‎ (9×)]

     

20:33

(cur | prev) . . (+5). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

     

20:32

(cur | prev) . . (+112). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

     

20:29

(cur | prev) . . (0). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

     

20:28

(cur | prev) . . (+13). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

     

20:28

(cur | prev) . . (-1). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

     

20:26

(cur | prev) . . (+1). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

     

20:26

(cur | prev) . . (+177). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

     

20:25

(cur | prev) . . (+7). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

     

20:24

(cur | prev) . . (+187). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

N    20:17  BME100 f2017:Group10 W0800 L3‎ (diff | hist) . . (+767). . Whitney Hirano (talk | contribs) (Created page with "5. The mean value of heart rate calculated from the pulse ox was 98.3673 beats/min with a standard deviation of 22.2273, while the mean value of heart rate calculated from the...")
     19:56  BME100 f2017:Group9 W0800 L3‎ (diff | hist) . . (+3). . Irene Zhang (talk | contribs) (LAB 3 WRITE-UP)

     19:52 

BME100 f2017:Projects1‎‎ (3 changes | history) . . (+19). . [Yar‎; Karmella Haynes‎ (2×)]

     

19:52

(cur | prev) . . (0). . Yar (talk | contribs) (small change to force cache purge)

     

19:37

(cur | prev) . . (+21). . Karmella Haynes (talk | contribs)

     

19:11

(cur | prev) . . (-2). . Karmella Haynes (talk | contribs) (Lab 1: “Needs Identification”)

     19:19  CONJ606:Schedule‎ (diff | hist) . . (+23). . Maureen E. Hoatlin (talk | contribs) (Week-by-Week Schedule Summary)

     19:06 

BME100 f2017‎‎ (2 changes | history) . . (+1). . [Karmella Haynes‎ (2×)]

     

19:06

(cur | prev) . . (-8). . Karmella Haynes (talk | contribs)

     

19:06

(cur | prev) . . (+9). . Karmella Haynes (talk | contribs)