Difference between revisions of "User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert"

From OpenWetWare
Jump to: navigation, search
(4/4/13)
(4/11/13)
(One intermediate revision by the same user not shown)
Line 164: Line 164:
  
 
picked colonies. by ejecting pipet tip into tube.  
 
picked colonies. by ejecting pipet tip into tube.  
 +
 +
==4/11/13==
 +
1)miniprep culture<br>
 +
2) restriction map EcoRI/XhoI<br>
 +
6ul H2O<br>
 +
1ul buffer<br>
 +
2ul DNA<br>
 +
0.5ul XhoI<br>
 +
0.5ul EcoRI<br>
 +
put in thermo cycler 11:23<br>
 +
3) run a gel<br>
 +
Lane 7-Sample A<br>
 +
Lane 8-Sample B<br>
 +
Lane 9-Sample C<br>
 +
 +
4) Put all juice from 2 good clones in plate to be sent for sequencing.<br>
  
 
|-
 
|-

Revision as of 11:58, 11 April 2013

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext"></div><div style="display:none;" id="page">User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages <html><img src="/images/a/aa/Help.png" border="0" /></html>

SSB13 140L Vanillin synthon - CCOMT-2

  • Assigned Sequence: Stephanie Sibert CCOMT-2 GCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAAGGATGCAGTTTT
    GGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAA
    TAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
    TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTG
    CCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
    397 >Medicago sativa caffeic acid methyltransferase bin 2

Notes

  • Need to use Eco-Bam for digestion
  • Pieces given:

CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC

  • Predicted PCR Product:

ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCAT
GGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTT
AATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGTCATTGA
GGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT


Construction File

PCA CCOMT-2 oligos 1-16, PCA1 Template:SBB-PCA (457, pca1)
PCR pca1 with universalFwd/universalRev, PCA2 (457, pca2)
Digest pca2 with EcoRI/BamHi (changed from BglII), gp (412+26+19 bp, pcr_dig)
(get pre-digested vector from JCA of pBca9145-Bca1144 (EcoRI/BamHI, vect_dig)
Ligate pcr_dig and vect_dig,2469bp, transform, pick white colonies, map, sequence


>Well Position, Name,Sequence >E7, CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
>F7, CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
>G7, CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
>H7, CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
>A8, CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
>B8, CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
>C8, CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
>D8, CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
>E8, CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
>F8, CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
>G8, CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
>H8, CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
>A9, CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
>B9, CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
>C9, CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
>D9, CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC
>A5, universalFwd ATATAGATGCCGTCCTAGC
>B5, universalRev AAGTATCTTTCCTGTGCCCA

>PCA1/2
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAA
TGGAGTCATGGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCAT
GGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACA
GGTTTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAA
GGTATTAATTTTGATTTGCCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGA
AAGATACTT

>final product
GAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAA
GGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAA
GTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGT
CATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCtaaCTCGAGctgcaggcttcctcgctcactgactcgc
tgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaa
gaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacgag
catcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgc
gctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtag
gtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaac
tatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcg
gtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttacctt
cggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcaga
aaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatga
gattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctga
cagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagata
actacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataa
accagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagt
aagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattc
agctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtca
gaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgt
gactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcg
ccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagtt
cgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgc
cgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgt
ctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtct
aagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaa
ggatgatttctg

3/3/12

PCA 1 with contents of CCOMT-2 tube.

3/12/13

Template:SBB-Protocols_Zymo1

Template:SBB-PCA Amplification Step

Digest Eco/Bam

Given to Jon to run program

3/13/13

GEL RUN
This gel is of the PCA2 products for the various synthons. The first lane is the His-tag part's IPCR product (currently unnamed), then molecular weight standards, then the rest are your PCA2's (I couldn't read the labels). All but three look fine. Lanes 4 and 8 look recoverable with a second PCR. The lane 3's reaction needs to be started over from scratch. Lane 7 just needs a careful gel purification.

My sample is the third sample (lane 5)
2013 03 13-JCA-gel1.jpg


3/14/13

Template:SBB-Protocols_Zymo1 Ran gel, cut, melted in zymo buffer. Froze before column step.

3/19/13

Zymo column

3/21/13

ligate [SBB-Protocols_Enz4]
transform
used PCR tubes to fit in incubator.

4/2/13

only 3 colonies in my plate. Only 2 colonies from class had reasonable results.
Run gel on digest from 3/14/13. With Wells at the top, counting from left to right, lane 3. Gel 2.
Set up new digest from pcr products in tube labeled 3/12/13
started incubation at 10:40
removed from incubator 11:40
zymo cleanup column

4/4/13

Ligations 6.5uL ddH2O 1uL Ligation buffer 1uL vector 1uL insert 0.5uL enzyme (last)

Comp Cells 1 tube cells 30uL KCM (no ddH2O)

4/9/13

no colonies in new plate, 3 colonies in old plate will be used to proceed.

picked colonies. by ejecting pipet tip into tube.

4/11/13

1)miniprep culture
2) restriction map EcoRI/XhoI
6ul H2O
1ul buffer
2ul DNA
0.5ul XhoI
0.5ul EcoRI
put in thermo cycler 11:23
3) run a gel
Lane 7-Sample A
Lane 8-Sample B
Lane 9-Sample C

4) Put all juice from 2 good clones in plate to be sent for sequencing.

Recent changes

25 September 2017

     12:14 

(Upload log). .

[Trevor S. Heaton‎; Anshul Krishnan‎ (2×); Vinh T. Le‎ (3×)]

     

12:14

. . Vinh T. Le (talk | contribs) uploaded File:ZOLA9252017 3.PNG

     

12:14

. . Vinh T. Le (talk | contribs) uploaded File:ZOLA9252017 2.PNG

     

12:13

. . Vinh T. Le (talk | contribs) uploaded File:ZOLA9252017 1.PNG

     

09:18

. . Trevor S. Heaton (talk | contribs) uploaded a new version of File:Graph 1.PNG

     

06:18

. . Anshul Krishnan (talk | contribs) uploaded File:BME100TempVTrials.png

     

06:10

. . Anshul Krishnan (talk | contribs) uploaded File:BME100L3Temp.png

24 September 2017

N    22:33  MediaWiki:Tagline‎ (diff | hist) . . (+16). . Yardena Cohen (talk | contribs) (less parsing)
N    22:32  MediaWiki:Pagetitle-view-mainpage‎ (diff | hist) . . (+11). . Yardena Cohen (talk | contribs) (less parsing)
N    22:32  MediaWiki:Opensearch-desc‎ (diff | hist) . . (+16). . Yardena Cohen (talk | contribs) (english-only?)
N    21:21  MediaWiki:Pagetitle‎ (diff | hist) . . (+16). . Yardena Cohen (talk | contribs) (idk if this will help or hurt)
N    21:18  MediaWiki:Aboutsite‎ (diff | hist) . . (+17). . Yardena Cohen (talk | contribs) (one less thing to parse)

     20:08 

(Upload log). .

[Anna Hoge‎ (2×)]

     

20:08

. . Anna Hoge (talk | contribs) uploaded File:AHgraph4.png

     

18:52

. . Anna Hoge (talk | contribs) uploaded File:AHgraph3.png

23 September 2017

     17:17  MediaWiki:Contactpage-pagetext‎ (diff | hist) . . (+36). . Yardena Cohen (talk | contribs) (don't ask me science questions plz)

     17:05 

(Deletion log). .

[Yardena Cohen‎ (6×)]

     

17:05

. . Yardena Cohen (talk | contribs) deleted page User talk:Deepak P Patil(Automatically deleted when merging users)

     

17:05

. . Yardena Cohen (talk | contribs) deleted page User:Deepak P Patil(Automatically deleted when merging users)

     

16:39

. . Yardena Cohen (talk | contribs) deleted page User talk:Chun H Hsieh(Automatically deleted when merging users)

     

16:39

. . Yardena Cohen (talk | contribs) deleted page User:Chun H Hsieh(Automatically deleted when merging users)

     

15:39

. . Yardena Cohen (talk | contribs) deleted page User talk:Satu Strandman(Automatically deleted when merging users)

     

15:39

. . Yardena Cohen (talk | contribs) deleted page User:Satu Strandman(Automatically deleted when merging users)

     17:05 

(User merge log). .

[Yardena Cohen‎ (6×)]

     

17:05

. . Yardena Cohen (talk | contribs) Deleted user: Deepak P Patil (8544) ‎

     

17:05

. . Yardena Cohen (talk | contribs) User Deepak P Patil (8544) merged to Anonymous (0) ‎

     

16:39

. . Yardena Cohen (talk | contribs) Deleted user: Chun H Hsieh (13046) ‎

     

16:39

. . Yardena Cohen (talk | contribs) User Chun H Hsieh (13046) merged to Anonymous (0) ‎

     

15:39

. . Yardena Cohen (talk | contribs) Deleted user: Satu Strandman (13640) ‎

     

15:39

. . Yardena Cohen (talk | contribs) User Satu Strandman (13640) merged to Anonymous (0) ‎

N    14:04 

MediaWiki:Contactpage-label‎‎ (2 changes | history) . . (+7). . [Yardena Cohen‎ (2×)]

     

14:04

(cur | prev) . . (-4). . Yardena Cohen (talk | contribs) (one word so it doesn't get wrapped)

N    

13:59

(cur | prev) . . (+11). . Yardena Cohen (talk | contribs) (label text for footer?)

     14:02 

New server‎‎ (2 changes | history) . . (-137). . [Yardena Cohen‎ (2×)]

     

14:02

(cur | prev) . . (+10). . Yardena Cohen (talk | contribs) (contact form)

     

11:34

(cur | prev) . . (-147). . Yardena Cohen (talk | contribs) (it happened)

N    14:01 

MediaWiki:Contactpage-url‎‎ (4 changes | history) . . (+21). . [Yardena Cohen‎ (4×)]

     

14:01

(cur | prev) . . (-23). . Yardena Cohen (talk | contribs) (relative again)

     

14:01

(cur | prev) . . (-10). . Yardena Cohen (talk | contribs) (actual url)

     

13:59

(cur | prev) . . (+23). . Yardena Cohen (talk | contribs) (full url?)

N    

13:57

(cur | prev) . . (+31). . Yardena Cohen (talk | contribs) (relative link)

     13:52 

(User rights log). .

[Yardena Cohen‎ (2×)]

     

13:52

. . Yardena Cohen (talk | contribs) changed group membership for Oww Op from bureaucrat and administrator to staff ‎

     

13:52

. . Yardena Cohen (talk | contribs) changed group membership for Oww Op from (none) to administrator and bureaucrat ‎

     13:47 (User creation log) . . User account Oww Op (talk | contribs) was created by Yardena Cohen (talk | contribs) and password was sent by email ‎
     11:34 (Patrol log) . . Yardena Cohen (talk | contribs) automatically marked revision 996201 of page New server patrolled ‎
     11:33  BIOL398-04/S15:Class Assignments by Week‎ (diff | hist) . . (-3). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Tessa A. Morris Class Assignments by Week to Tessa Morris Class Assignments by Week in a maintenance job.)
     11:33  Paris Bettencourt 2012/Notebook/modularity group/day by day/2012/07‎ (diff | hist) . . (+1). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from IGEM:Paris Bettencourt 2012/Notebook/modularity group/day by day//2012/07 to IGEM:Paris Bettencourt 2012/Notebooks/modularity group/day by day//2012/07 in a maintenance job.)
     11:33  Paris Bettencourt 2012/Notebook/modularity group/day by day/2012/07/03‎ (diff | hist) . . (+1). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from IGEM:Paris Bettencourt 2012/Notebook/modularity group/day by day//2012/07/03 to IGEM:Paris Bettencourt 2012/Notebooks/modularity group/day by day//2012/07/03 in a maintenance job.)
     11:33  BIOMOD/2012/TeamSendaiA/Methods‎ (diff | hist) . . (-1). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from BIOMOD/2012/TeamSendaiA/Methodsa to Biomod/2012/TeamSendaiA/Methods in a maintenance job.)
     11:33  Biomod/2012/TU Dresden/Nanosaurs/Project/Sponsor‎ (diff | hist) . . (+1). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Biomod/2012/TU Dresden/Nanosaurs/Sponsor to Biomod/2012/TU Dresden/Nanosaurs/Sponsors in a maintenance job.)
     11:33  User:Etienne Robillard/Notebook/Phenylmethylamine‎ (diff | hist) . . (-6). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from User:Etienne Robillard/Notebook/Phenylmethanamine to User:Etienne Robillard/Notebook/Benzylamine in a maintenance job.)
     11:33  Farre Lab:Teaching & Research Program‎ (diff | hist) . . (-18). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Farre Lab:Teaching&Research Program to Farre Lab:NSF T&R in a maintenance job.)
     11:33  Farre Lab:Teaching&Research Program‎ (diff | hist) . . (-24). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Farre Lab:Farre-Teaching&Research Program to Farre Lab:NSF T&R in a maintenance job.)
     11:33  Farre Lab:Farre-Teaching&Research Program‎ (diff | hist) . . (-21). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Farre Lab:NSFTeaching&Research Program to Farre Lab:NSF T&R in a maintenance job.)
     11:33  User:Etienne Robillard/Notebook/Chemtrails911 notebook/Agent Ecoli:PhotoReceptorComponent‎ (diff | hist) . . (-26). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from User:Etienne Robillard/Notebook/Agent Ecoli:PhotoReceptorComponent to User:Etienne Robillard/Notebook/Agent BZ in a maintenance job.)
     11:33  BIOX‎ (diff | hist) . . (+9). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Liu BioX to Template:Liu BioX in a maintenance job.)