Difference between revisions of "User:Megan E. Garber/Notebook/BioE140L - synthesis of vanillin/Entry Base"

From OpenWetWare
Jump to: navigation, search
(March 5th 2013)
(March 5th 2013)
Line 6: Line 6:
 
| colspan="2"|
 
| colspan="2"|
 
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
 
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
== March 5th 2013==
 
Synthesis of vanillin part asbF-1
 
  
Construction File
 
Mix oligos for one synthon, do PCA1 protocol              (517bp, pca1)
 
 
PCR pca1 with asbF-1_oligo_3 and asbF-1_oligo_1 by PCA2 protocol        (517bp, pca2)
 
 
Digest pca2 with EcoRI/BamHI (yes, BamHI), gp                (472+26+19 bp, pcr_dig)
 
 
(get pre-digested vector from JCA of pBca9145-Bca1144 
 
 
Ligate pcr_dig and vect_dig, transform, pick white colonies, map, sequence
 
 
asbF-1_oligo_3
 
>ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCT
 
 
asbF-1_oligo_1
 
> AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCATCTAATAAGACGTACA
 
 
Predict the product of each assembly step:
 
 
pca1
 
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT
 
 
pca2
 
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT
 
 
digestion with eco/bam
 
'''AATTC'''ATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCAT'''G'''
 
 
'''Thursdays Plan'''
 
Do Pca1 with vanillin asbF-1
 
'''PCA protocol'''[http://openwetware.org/wiki/Template:SBB-PCA]
 
 
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
 
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
 
|}
 
|}
  
 
__NOTOC__
 
__NOTOC__

Revision as of 21:52, 12 March 2013

Owwnotebook icon.png Project name <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page