Difference between revisions of "User:Megan E. Garber/Notebook/BioE140L - synthesis of vanillin/2013/03/12"

From OpenWetWare
Jump to: navigation, search
(Autocreate 2013/03/12 Entry for User:Megan_E._Garber/Notebook/BioE140L_-_synthesis_of_vanillin)
 
(March 5th 2013)
Line 6: Line 6:
 
| colspan="2"|
 
| colspan="2"|
 
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
 
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
== March 5th 2013==
+
== March 12th 2013==
Synthesis of vanillin part asbF-1
 
  
Construction File
+
Today in lab I did Pca1 zymo clean up and amplification steps with vanillin asbF1-1 and asbF1-3
Mix oligos for one synthon, do PCA1 protocol              (517bp, pca1)
 
 
PCR pca1 with asbF-1_oligo_3 and asbF-1_oligo_1 by PCA2 protocol        (517bp, pca2)
 
 
Digest pca2 with EcoRI/BamHI (yes, BamHI), gp                (472+26+19 bp, pcr_dig)
 
 
(get pre-digested vector from JCA of pBca9145-Bca1144 
 
 
Ligate pcr_dig and vect_dig, transform, pick white colonies, map, sequence
 
 
 
asbF-1_oligo_3
 
>ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCT
 
 
 
asbF-1_oligo_1
 
> AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCATCTAATAAGACGTACA
 
 
 
Predict the product of each assembly step:
 
 
 
pca1
 
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT
 
 
 
pca2
 
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT
 
 
 
digestion with eco/bam
 
'''AATTC'''ATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCAT'''G'''
 
 
 
'''Thursdays Plan'''
 
Do Pca1 with vanillin asbF-1
 
 
'''PCA protocol'''[http://openwetware.org/wiki/Template:SBB-PCA]
 
'''PCA protocol'''[http://openwetware.org/wiki/Template:SBB-PCA]
 
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
 
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->

Revision as of 21:42, 12 March 2013

Owwnotebook icon.png Project name <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

March 12th 2013

Today in lab I did Pca1 zymo clean up and amplification steps with vanillin asbF1-1 and asbF1-3 PCA protocol[1]