Difference between revisions of "User:Megan E. Garber/Notebook/BioE140L - synthesis of vanillin"

From OpenWetWare
Jump to: navigation, search
(Autocreated Lab Notebook name=User:Megan E. Garber/Notebook/BioE140L - synthesis of vanillin, content from MediaWiki:ProjectContentDefault)
 
(Notes)
Line 19: Line 19:
  
 
==Notes==
 
==Notes==
* Place some notes here for visitors
+
'''March 5 2013'''
 +
Synthesis of vanillin part asbF-1
  
* Example: This project is currently on hold until further notice.
+
Construction File
 +
Mix oligos for one synthon, do PCA1 protocol              (517bp, pca1)
 +
 +
PCR pca1 with asbF-1_oligo_3 and asbF-1_oligo_1 by PCA2 protocol        (517bp, pca2)
 +
 +
Digest pca2 with EcoRI/BamHI (yes, BamHI), gp                (472+26+19 bp, pcr_dig)
 +
 +
(get pre-digested vector from JCA of pBca9145-Bca1144 
 +
 +
Ligate pcr_dig and vect_dig, transform, pick white colonies, map, sequence
  
 +
asbF-1_oligo_3
 +
>ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCT
  
 +
asbF-1_oligo_1
 +
> AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCATCTAATAAGACGTACA
 +
 +
Predict the product of each assembly step:
 +
 +
pca1
 +
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT
 +
 +
pca2
 +
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT
 +
 +
digestion with eco/bam
 +
'''AATTC'''ATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCAT'''G'''
 +
 +
'''Thursdays Plan'''
 +
Do Pca1 with vanillin asbF-1
 
|-
 
|-
 
|colspan="2" style="background-color: #F2F2F2;"|
 
|colspan="2" style="background-color: #F2F2F2;"|

Revision as of 12:18, 5 March 2013

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext">03/05/2013,03/12/2013,03/14/2013,03/15/2013</div><div style="display:none;" id="page">User:Megan E. Garber/Notebook/BioE140L - synthesis of vanillin</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages <html><img src="/images/a/aa/Help.png" border="0" /></html>

Project Description/Abstract

  • Place short description of project or notes regarding this project
  • Lorem ipsum dolor sit amet, consectetuer adipiscing elit. Donec porta commodo tellus. Nam a est eget libero mollis tincidunt. Aliquam purus. Quisque nulla ligula, facilisis in, pulvinar sed, molestie a, quam. Vestibulum at pede. In in sem eget odio eleifend placerat. Phasellus ultricies felis quis sapien. Etiam molestie volutpat quam. Praesent pulvinar scelerisque mi. Nam mi urna, fringilla eu, mattis sed, venenatis id, nunc. Maecenas velit eros, congue ut, placerat in, ornare vel, sem. Aenean porta enim sit amet felis gravida posuere. Phasellus faucibus nibh et orci.

Notes

March 5 2013 Synthesis of vanillin part asbF-1

Construction File Mix oligos for one synthon, do PCA1 protocol (517bp, pca1)

PCR pca1 with asbF-1_oligo_3 and asbF-1_oligo_1 by PCA2 protocol (517bp, pca2)

Digest pca2 with EcoRI/BamHI (yes, BamHI), gp (472+26+19 bp, pcr_dig)

(get pre-digested vector from JCA of pBca9145-Bca1144

Ligate pcr_dig and vect_dig, transform, pick white colonies, map, sequence

asbF-1_oligo_3 >ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCT

asbF-1_oligo_1 > AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCATCTAATAAGACGTACA

Predict the product of each assembly step:

pca1 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT

pca2 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT

digestion with eco/bam AATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCATG

Thursdays Plan Do Pca1 with vanillin asbF-1

Recently Edited Notebook Pages