User:Kateryna Kozyrytska

From OpenWetWare
Revision as of 14:41, 6 November 2008 by Patrick Wu (talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

I am a new member of OpenWetWare!

Contact Info

Kateryna Kozyrytska (an artistic interpretation)

I study at MIT. I learned about OpenWetWare from professor, and I've joined because I am taking a class that requires an account.

Education

  • SB 2011, MIT

Research interests

YGR067C: ATGGCTGCGGGTCAAAAAAAATATATATGTTCCTTTTGTTTGAAGCCTTTCTCGAGATCC GAGCACAAGATAAGGCATGAAAGGTCTCATGCGGGCGTGAAGCCTTTCCAGTGCCAAGTC TGTAAACACTCTTTTGTTAGACGCGATCTCTTACAGCGACACATCAGGACTGTCCACAGA ACCTTCCTCTTATCCAGTTACGCGTCAATGACAGGCGATAAGGCTGATATCCCTGTATCA CTTGGCGTTGGTGACGTTGATTCGACTTCACCCAGAGATATCAAAATGGAAACACTCGTT AATTCGATGATTAAGGTCAACAGCGGCCTTATCAATATTCACTATCATAGTAGTAATGTT GAAAAAATGGATAAGCAGCAACGTTGTGTGATTGGGAAGGAGTCCTCTAGTTTAAAGAAA GGGAAAAGCCGCTTTAAGCAGGTTAAAAGCCGGTTGGAGTCCTCCATCAGTGTAAAAATT TTGCAAGAATATTCATTAGATTTTATTAGCTCAAGAGATATTCTAACTTTCTTCAGAATG GGTGTAAGCCACTTGGTAGAAAATAAGATCTTCCAAAATTTCTTTCCAGACCTGTTCTCA TCACTACAAAATGACGAGCTGGTGGAAAGTTTTTGGATTAACAAGCCTTTTGGTCTCATA ATAGCTTGTCTGGGTATGTCCATTTCGTTAAATCAAGATTCTCAAAAACTATGGTTTATC TGTTGTACGAATTTGTATGCTAGCTCATCTAAACATGACAATGACTTTGACACTGAGGAC ATTTTGTCACAGACAGAGCAACATGATGTTTTTGCCTTGATTCTATTTTATTCTCTTCTA GTAATGTTGGAGAATAACATTCCTGTTTCTAATTCCATTAAAAAGTTCGATGTGTTTTCA ATGCTTCAAGATATTCTGAAGCCATTCACCGTGGCATCCTCCAGTTACCATTATTTGAAT AGTAAGGAAAATGCATGGTTCATATTCGATCTATGGGTCAATATCTTGCGCGATTCAAAC AACTTCAACAACGATTCTTTACTAATATTTGGTTGGTTCGTCAATCAAGAGTTTATTTCG TCTAATCCACTTAAGGACTTCATATACAAGGGACCGTCAATGTCCACTACTGACTTAACT TTAAAGCATATCAATATTTTGGCAGATTCCGCGTACGTGTATTTTATAATAAAGAAGACT TATCCGCAAGAGCTGCCATCTGATTTTAGAGTGCATGATTTGCTGGTTTACTTGAATGAA TGTTTCGTAATGCAGCAGCCGATCAAACCTGAAACTAGTGCAAACCCCTCTTTATTTGCG AACGTTATGAACGCCAGGATTACGGACTGCAAATCGAAAAGTAACTGGTTATTGTGGGAA ACGATTTGGTTCGAATTCATCAACAACTTGACTTTGAGAAATGGGACCACAAGGAACATA TGGTTCATTGATAACTTTCCACAGGTATCGACCTCGTGCTTACTTCATCATTCTTCCTCA TTTGTTGATGAAACCTTGATCACCACGAACTTATCAATCATATCAATGCTTCTTAATTTG AAGTCTTTCACGCTGGCATCTTTAAACCCAAGGAATATTCAGTTAATTACCGACATTGTC AGCTTCCAACTAAAATTGTTTTCATCGGAGTTAATTGCAAGCTCGGATGTTTCACCATCA CAAGTATCTCAATTACTAGTAAACCCCAATGTTCACCTAATGTTATATTTCTGGTTCGAT ACCATTTATGTACAACGTCAGAGCTACCTTTCATCAACAGAGAAAGAGGAATTTGAGAAG GTTGAAGTGTTTGTGAATGACTACATTATAACACACCAAAAGAACTTGGTGACAGACTTA CACTCCATTTTGTTCGATTTTTGGTCAGATTCCTTCATTGCTTACCATATACTACTGCAT GCTATTGTATCTTCATTAAGAGATAATATTCTTTACCCATACTTAATCTACTCCCCTCAC CTGAATGACCAGACGAAAGCATTGTTGACTGATATCTCTAATTGGTCTTGTTTTGCTCTT CAACAGCCGTTTCGCAAGACTTCAAGAGGTTCTTTATCTGGTGCTTCTGATATGAAATCG TTTTCAGTAGCATCATGTTTGCCACTCTCTCCTAATTTCCTAAAGAGAGATTCAAACTGT AATAAGATTCTCCTGCCCCCATTAGATATAAAAGCCATTGAACCTATCTCAACGAGTAAT TACACCTACGTGAACTCGGCCCCTAAGCAACAAGAGAAGGAACAACCATTGTTAAGGGCA ACAGGAAACAATATCAATTTAGTCCAAACAATAGTGGTCCCACCCCAGGTAAACATGGAA TCACAAGAATTCTCAGCTTCTTCAACTGACAATAAACAAAGTTAA

YGR067C-TAP tagging: Forward Primer: CAAGAATTCTCAGCTTCTTCAACTGACAATAAACAAAGTTCCATGGAAAAGAGAAGATG G/C 33.9% Tm 64.7 C

Reverse Primer: CTTTGGCCATTATTTTATTTGGCTAAAAATTTCAATGTTTACGACTCACTATAGGGCGA G/C 33.9% Tm 65.4 C

Module 3 Link

Click here for more info.

Publications

  1. Goldbeter A and Koshland DE Jr. An amplified sensitivity arising from covalent modification in biological systems. Proc Natl Acad Sci U S A. 1981 Nov;78(11):6840-4. PubMed ID:6947258 | HubMed [Paper1]
  2. JACOB F and MONOD J. Genetic regulatory mechanisms in the synthesis of proteins. J Mol Biol. 1961 Jun;3:318-56. PubMed ID:13718526 | HubMed [Paper2]

    leave a comment about a paper here

  3. ISBN:0879697164 [Book1]

All Medline abstracts: PubMed | HubMed

Useful links