Difference between revisions of "User:Karmella Haynes/Notebook/BioBrick cloning/2013/03/14"

From OpenWetWare
Jump to: navigation, search
(04/14/13)
(04/14/13)
Line 8: Line 8:
 
==04/14/13==
 
==04/14/13==
 
<!-- Precede finished items with a checkmark &#x2713; -->
 
<!-- Precede finished items with a checkmark &#x2713; -->
* New vectors: design new vectors for mammalian expression
+
* New vector: design new vector for mammalian expression
 
* Order oligos
 
* Order oligos
  
  
 
----
 
----
'''New mammalian expression vectors MV9 and MV10'''<br>
+
'''New mammalian expression vector MV9 and MV10'''<br>
  
 
* Use the [http://gcat.davidson.edu/igem10/ Oligator tool] to design oligo-assembly inserts for "MV6" (pcDNA3.1+ puro, mammalian transfection vector; CMV promoter)
 
* Use the [http://gcat.davidson.edu/igem10/ Oligator tool] to design oligo-assembly inserts for "MV6" (pcDNA3.1+ puro, mammalian transfection vector; CMV promoter)
** MV9 - will carry Kozak-XbaI-NLS-6His-stop (Brady's and Behzad's project)
+
* MV9 - will carry Kozak-XbaI-NLS-6His-stop (for Brady's and Behzad's projects)
** MV10 - will carry Kozak-XbaI-stop
 
 
* Oligo assembly method will be used to make double stranded DNA with SpeI overhangs
 
* Oligo assembly method will be used to make double stranded DNA with SpeI overhangs
* Inserts will be ligated to XbaI cut MV6 to destroy the preexisting XbaI site
+
* Insert will be ligated to XbaI-cut MV6 to destroy the preexisting XbaI site
 
* Clones will be screened for proper orientation and insert copy number
 
* Clones will be screened for proper orientation and insert copy number
  
Line 34: Line 33:
 
# 30-mer 5'-CTAGTCTCAGCTTTACGCGTGATGGTGGTG
 
# 30-mer 5'-CTAGTCTCAGCTTTACGCGTGATGGTGGTG
  
'''Kozak-XbaI-stop'''<br>
 
  
 
 
----
 
'''Assemblies'''
 
# BioBrick name: 5' part/(a/b)/size + 3' part/(c/d)/size
 
# BioBrick name: 5' part/(a/b)/size + 3' part/(c/d)/size
 
 
 
* Digests (Fermentas FD)
 
** Specific notes
 
 
{| {{table}} cellspacing="3" <!-- Digest rxn. table -->
 
|- valign="top"
 
| bgcolor=#cfcfcf | Reagent
 
| bgcolor=#cfcfcf | Volume
 
| rowspan="7" | <!-- [[Image:GelImage.jpg|270px|Hover name]]<br>30 μL/lane, 1% agarose; [http://openwetware.org/wiki/Image:KAH_Fermentas_GeneRuler_1kbplus.jpg Ladder] -->
 
|-
 
| DNA (plasmid) || up to 25 μL
 
|-
 
| 10x buffer || 3.0
 
|-
 
| enzyme 1 || 1.0
 
|-
 
| enzyme 2 || 1.0
 
|-
 
| dH<sub>2</sub>O || ---
 
|-
 
| &nbsp; || 30 μL --> 37°C/ ~30 min.
 
|}
 
 
 
* Measure conc.'s
 
{| {{table}} cellspacing="3" <!-- [DNA] table -->
 
|- bgcolor=#cfcfcf
 
| Sample || OD260 || 260/280 || ng/μL
 
|-
 
| 1. Digested part (a/b) || --- || --- || ---
 
|-
 
| 2. Digested part (c/d) || --- || --- || ---
 
|}
 
 
 
* Dephosphorylation (Roche)
 
{| {{table}} cellspacing="3" <!-- Dephos table -->
 
|-
 
| bgcolor=#cfcfcf | Reagent
 
| bgcolor=#cfcfcf | Volume
 
|-
 
| DNA (clean digest) || up to 17 μL (500 ng)
 
|-
 
| 10x buffer d.p. || 2.0
 
|-
 
| phosphatase || 1.0
 
|-
 
| dH<sub>2</sub>O || ---
 
|-
 
| &nbsp; || 20 μL --> 37°C/ 10 min.; 75°C/ 2 min.; [final] = 25 ng/μL
 
|}
 
 
 
* Ligations
 
{| {{table}} cellspacing="3" <!-- Ligations table -->
 
|- bgcolor=#cfcfcf
 
| Ligation || <font color="blue"><u>Plate results (lig : neg crtl)</u> mm/dd/yy</font>
 
|-
 
| 1. insert(a/b)/size, ## ng + vector(c/d)/size, ## ng || <font color="blue">new BioBrick #:1 (Pick #)</font>
 
|-
 
| 2. vector(c/d)/ ## ng || &nbsp;
 
|}
 
 
{| {{table}} cellspacing="3" <!-- Ligation rxn table -->
 
| &nbsp;            || 1    || 2    ||
 
|-
 
| Insert DNA        || ###  || ---  ||
 
|-
 
| Vector DNA        || ###  || ###  ||
 
|-
 
| 2x lgn buf (Roche) || ###  || ###  ||
 
|-
 
| T4 ligase (NEB)    || 1.0  || 1.0  ||
 
|-
 
| dH<sub>2</sub>O    || ###  || ###  ||
 
|-
 
| &nbsp;            || # μL || # μL ||
 
|}
 
 
----
 
'''Oligo annealing'''
 
# New BB 1
 
# New BB 2
 
 
{| class="wikitable" border="0" cellspacing="3" <!-- Oligo annealing rxn table -->
 
| DNA (oligos, 100 μM) || up to 18 μL (3 μL ea.)
 
|-
 
| 10x annealing buffer || 2.0
 
|-
 
| dH<sub>2</sub>O || ---
 
|-
 
| &nbsp; || 20 μL --> 100°C (water bath)/ 5 min.; Cool to R.T. overnight
 
|}
 
  
  

Revision as of 18:19, 14 March 2013

Owwnotebook icon.pngKarmella's BioBrick Cloning <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

04/14/13

  • New vector: design new vector for mammalian expression
  • Order oligos



New mammalian expression vector MV9 and MV10

  • Use the Oligator tool to design oligo-assembly inserts for "MV6" (pcDNA3.1+ puro, mammalian transfection vector; CMV promoter)
  • MV9 - will carry Kozak-XbaI-NLS-6His-stop (for Brady's and Behzad's projects)
  • Oligo assembly method will be used to make double stranded DNA with SpeI overhangs
  • Insert will be ligated to XbaI-cut MV6 to destroy the preexisting XbaI site
  • Clones will be screened for proper orientation and insert copy number

Oligator results:

Kozak-XbaI-NLS-6His-stop
CTAGTCCCGCCGCCACCATGGAGTCTAGACCCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGA     AGGGCGGCGGTGGTACCTCAGATCTGGGTTCTTTTTCGCGTTCCATGTGGTAGTGGTGGTAGTGCGCATTTCGACTCTGATC

  1. 30-mer 5'-CTAGTCCCGCCGCCACCATGGAGTCTAGAC
  2. 52-mer 5'-CCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGA
  3. 52-mer 5'-ATGGTGTACCTTGCGCTTTTTCTTGGGTCTAGACTCCATGGTGGCGGCGGGA
  4. 30-mer 5'-CTAGTCTCAGCTTTACGCGTGATGGTGGTG