Difference between revisions of "User:Karmella Haynes/Notebook/BioBrick cloning/2013/01/02"

From OpenWetWare
Jump to: navigation, search
(fix raw html notebook nav)
(2 intermediate revisions by one other user not shown)
Line 2: Line 2:
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;">Karmella's BioBrick Cloning</span>
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;">Karmella's BioBrick Cloning</span>
|style="background-color: #F2F2F2" align="center"|<html><img src="/images/9/94/Report.png" border="0" /></html> [[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>[[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]]<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>}}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]]<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>}}
|style="background-color: #F2F2F2" align="center"|[[File:Report.png|frameless|link={{#sub:{{FULLPAGENAME}}|0|-11}}]][[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|[[File:Resultset_previous.png|frameless|link={{#lnpreventry:{{FULLPAGENAME}}}}]][[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]]&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;}}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]][[File:Resultset_next.png|frameless|link={{#lnnextentry:{{FULLPAGENAME}}}}]]}}
| colspan="2"|
| colspan="2"|
Line 37: Line 37:
# gg_BBP-hPCD F: 5'-'''cgtctc'''CTAGAtggagctttcagcggtggg
# gg_BBP-hPCD F: 5'-'''cgtctc'''CTAGAtggagctttcagcggtggg
# gg_hPCD-BL01 R: 5'-'''cgtctc'''TCCATtctttccctttcctcaaagg
# gg_hPCD-BL01 R: 5'-'''cgtctc'''TCCATtctttccctttcctcaaagg
# gg_
# gg_BL01 F: 5'-'''cgtctc'''atggagctttcagcggtggg
# gg_BL01-BBS R: 5'-'''cgtctc'''CTAGTgccaggatcccccgagcccc

Latest revision as of 21:20, 26 September 2017

Owwnotebook icon.pngKarmella's BioBrick Cloning Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png


  • Gibson assembly: order primers for vector pSB1A3
  • Golden Gate assembly: order primers for pSB1A3 and Brady's parts
  • Order enzyme for Golden gate assembly: BsmBI

Gibson Assembly design

  • Previously tried to ligate Gibson insert into X/S-cut pSB1A3, unsuccessful. This time, PCR everything, including the vector, then do Gibson assembly.
  • Retry assembly "hPCD-BL01" (see [1]). Make sure primer sequence overlaps with Brady's external sequences:
    • BBP-hPCD fwd: gaattcgcggccgcttctaga-tggagctttcagcggtggg (first 21 = BioBrick prefix)
    • BL01-BBS rev: ctgcagcggccgctactagt-gccaggatcccccgagcccc (first 20 = BioBrick suffix)

New primers designed to amplify pSB1A3 backbone (should also work for V0120)

  1. Gib_BBS F: 5'-actagtagcggccgctgcag (forward seq from the BB suffix)
  2. Gib_BBP R: 5'-tctagatgcggccgcgaattc (reverse seq from the BB prefix)

Golden Gate design

  • Use BsmBI, per Dave Savage's recommendation
    • cgtctc - 5bp overlap - part - 5bp overlap - gcagaga
    • Forward - 5'-cgtctc NNNNN+20bp TOP
    • Reverse - 5'-cgtctc nnnnn+20bp rev comp

New primers

  1. gg_BBS F: 5'-cgtctcactagtagcggccgctgcag (should also work for V0120)
  2. gg_BBP R: 5'-cgtctctctagatgcggccgcgaattc (should also work for V0120)
  3. gg_BBP-hPCD F: 5'-cgtctcCTAGAtggagctttcagcggtggg
  4. gg_hPCD-BL01 R: 5'-cgtctcTCCATtctttccctttcctcaaagg
  5. gg_BL01 F: 5'-cgtctcatggagctttcagcggtggg
  6. gg_BL01-BBS R: 5'-cgtctcCTAGTgccaggatcccccgagcccc