Difference between revisions of "User:Karmella Haynes/Notebook/BioBrick cloning/2013/01/02"

From OpenWetWare
Jump to: navigation, search
(01/02/13)
Line 14: Line 14:
  
 
----
 
----
'''Gibson Assembly design'''<br>
+
'''Gibson Assembly design'''
 +
* Previously tried to ligate Gibson insert into X/S cut pSB1A3, unsuccessful. This time, PCR everything, including the vector, then do Gibson assembly.
 
* Retry assembly "hPCD-BL01" (see [http://openwetware.org/wiki/Haynes_Lab:Notebook/Engineering_PC-TFs/2012/12/07]). Make sure primer sequence overlaps with Brady's external sequences:
 
* Retry assembly "hPCD-BL01" (see [http://openwetware.org/wiki/Haynes_Lab:Notebook/Engineering_PC-TFs/2012/12/07]). Make sure primer sequence overlaps with Brady's external sequences:
 
** BBP-hPCD fwd: '''gaattcgcggccgcttctaga'''-tggagctttcagcggtggg (first 21 = BioBrick prefix)
 
** BBP-hPCD fwd: '''gaattcgcggccgcttctaga'''-tggagctttcagcggtggg (first 21 = BioBrick prefix)
 
** BL01-BBS rev: '''ctgcagcggccgctactagt'''-gccaggatcccccgagcccc (first 20 = BioBrick suffix)
 
** BL01-BBS rev: '''ctgcagcggccgctactagt'''-gccaggatcccccgagcccc (first 20 = BioBrick suffix)
#
 
  
 +
New primers designed to amplify pSB1A3 backbone (should also work for V0120)
 +
# Gib_BBS F: 5'-actagtagcggccgctgcag (forward seq from the BB suffix)
 +
# Gib_BBP R: 5'-tctagatgcggccgcgaattc (reverse seq from the BB prefix)
 +
 +
 +
 +
'''Golden Gate design'''
  
'''Primers: Golden Gate'''
 
  
  

Revision as of 16:59, 2 January 2013

Owwnotebook icon.pngKarmella's BioBrick Cloning <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

01/02/13

  • Gibson assembly: order primers for vector pSB1A3
  • Golden Gate assembly: order primers for pSB1A3 and Brady's parts
  • Order enzyme for Golden gate assembly:



Gibson Assembly design

  • Previously tried to ligate Gibson insert into X/S cut pSB1A3, unsuccessful. This time, PCR everything, including the vector, then do Gibson assembly.
  • Retry assembly "hPCD-BL01" (see [1]). Make sure primer sequence overlaps with Brady's external sequences:
    • BBP-hPCD fwd: gaattcgcggccgcttctaga-tggagctttcagcggtggg (first 21 = BioBrick prefix)
    • BL01-BBS rev: ctgcagcggccgctactagt-gccaggatcccccgagcccc (first 20 = BioBrick suffix)

New primers designed to amplify pSB1A3 backbone (should also work for V0120)

  1. Gib_BBS F: 5'-actagtagcggccgctgcag (forward seq from the BB suffix)
  2. Gib_BBP R: 5'-tctagatgcggccgcgaattc (reverse seq from the BB prefix)


Golden Gate design