|
|
Line 8: |
Line 8: |
| ==01/02/13== | | ==01/02/13== |
| <!-- Precede finished items with a checkmark ✓ --> | | <!-- Precede finished items with a checkmark ✓ --> |
| * Gibson assembly: order primers for vector V0120 | | * Gibson assembly: order primers for vector pSB1A3 |
| * Line item 2 | | * Golden Gate assembly: order primers for pSB1A3 and Brady's parts |
| | * Order enzyme for Golden gate assembly: |
|
| |
|
|
| |
|
| ---- | | ---- |
| '''Minipreps'''<br> | | '''Gibson Assembly design'''<br> |
| * Check with E/P digests | | * Retry assembly "hPCD-BL01" (see [http://openwetware.org/wiki/Haynes_Lab:Notebook/Engineering_PC-TFs/2012/12/07]). Make sure primer sequence overlaps with Brady's external sequences: |
| | ** BBP-hPCD fwd: '''gaattcgcggccgcttctaga'''-tggagctttcagcggtggg (first 21 = BioBrick prefix) |
| | ** BL01-BBS rev: '''ctgcagcggccgctactagt'''-gccaggatcccccgagcccc (first 20 = BioBrick suffix) |
| | # |
|
| |
|
| {| {{table}} border="1" cellspacing="3" <!-- Digest check rxn. table -->
| |
| |- valign="top"
| |
| | bgcolor=#cfcfcf | Reagent
| |
| | bgcolor=#cfcfcf | Volume
| |
| | rowspan="7" | <u>Expected:</u><br>1. BB 1 = size<br>2. BB2 = size<br>
| |
| | rowspan="7" | <!-- [[Image:GelImage.jpg|400px|Hover name]]<br>15 μL/lane; 1% agarose; [http://openwetware.org/wiki/Image:KAH_Fermentas_GeneRuler_1kbplus.jpg Ladder] -->
| |
| |-
| |
| | DNA(plasmid) || 2.0 μL
| |
| |-
| |
| | 10X buffer || 1.5
| |
| |-
| |
| | EcoRI || 1.0
| |
| |-
| |
| | PstI || 1.0
| |
| |-
| |
| | dH<sub>2</sub>O || 9.5
| |
| |-
| |
| | || 15 μL --> 37°C/ ~15 min.
| |
| |}
| |
|
| |
|
| ----
| | '''Primers: Golden Gate''' |
| '''Assemblies''' | |
| # BioBrick name: 5' part/(a/b)/size + 3' part/(c/d)/size
| |
| # BioBrick name: 5' part/(a/b)/size + 3' part/(c/d)/size
| |
| | |
| | |
| * Digests (Fermentas FD)
| |
| ** Specific notes
| |
| | |
| {| {{table}} cellspacing="3" <!-- Digest rxn. table -->
| |
| |- valign="top"
| |
| | bgcolor=#cfcfcf | Reagent
| |
| | bgcolor=#cfcfcf | Volume
| |
| | rowspan="7" | <!-- [[Image:GelImage.jpg|270px|Hover name]]<br>30 μL/lane, 1% agarose; [http://openwetware.org/wiki/Image:KAH_Fermentas_GeneRuler_1kbplus.jpg Ladder] -->
| |
| |-
| |
| | DNA (plasmid) || up to 25 μL
| |
| |-
| |
| | 10x buffer || 3.0
| |
| |-
| |
| | enzyme 1 || 1.0
| |
| |-
| |
| | enzyme 2 || 1.0
| |
| |-
| |
| | dH<sub>2</sub>O || ---
| |
| |-
| |
| | || 30 μL --> 37°C/ ~30 min.
| |
| |}
| |
| | |
| | |
| * Measure conc.'s
| |
| {| {{table}} cellspacing="3" <!-- [DNA] table -->
| |
| |- bgcolor=#cfcfcf
| |
| | Sample || OD260 || 260/280 || ng/μL
| |
| |-
| |
| | 1. Digested part (a/b) || --- || --- || ---
| |
| |-
| |
| | 2. Digested part (c/d) || --- || --- || ---
| |
| |}
| |
| | |
| | |
| * Dephosphorylation (Roche)
| |
| {| {{table}} cellspacing="3" <!-- Dephos table -->
| |
| |-
| |
| | bgcolor=#cfcfcf | Reagent
| |
| | bgcolor=#cfcfcf | Volume
| |
| |-
| |
| | DNA (clean digest) || up to 17 μL (500 ng)
| |
| |-
| |
| | 10x buffer d.p. || 2.0
| |
| |-
| |
| | phosphatase || 1.0
| |
| |-
| |
| | dH<sub>2</sub>O || ---
| |
| |-
| |
| | || 20 μL --> 37°C/ 10 min.; 75°C/ 2 min.; [final] = 25 ng/μL
| |
| |}
| |
| | |
| | |
| * Ligations
| |
| {| {{table}} cellspacing="3" <!-- Ligations table -->
| |
| |- bgcolor=#cfcfcf
| |
| | Ligation || <font color="blue"><u>Plate results (lig : neg crtl)</u> mm/dd/yy</font>
| |
| |-
| |
| | 1. insert(a/b)/size, ## ng + vector(c/d)/size, ## ng || <font color="blue">new BioBrick #:1 (Pick #)</font>
| |
| |-
| |
| | 2. vector(c/d)/ ## ng ||
| |
| |}
| |
|
| |
|
| {| {{table}} cellspacing="3" <!-- Ligation rxn table -->
| |
| | || 1 || 2 ||
| |
| |-
| |
| | Insert DNA || ### || --- ||
| |
| |-
| |
| | Vector DNA || ### || ### ||
| |
| |-
| |
| | 2x lgn buf (Roche) || ### || ### ||
| |
| |-
| |
| | T4 ligase (NEB) || 1.0 || 1.0 ||
| |
| |-
| |
| | dH<sub>2</sub>O || ### || ### ||
| |
| |-
| |
| | || # μL || # μL ||
| |
| |}
| |
|
| |
| ----
| |
| '''Oligo annealing'''
| |
| # New BB 1
| |
| # New BB 2
| |
|
| |
|
| {| class="wikitable" border="0" cellspacing="3" <!-- Oligo annealing rxn table -->
| |
| | DNA (oligos, 100 μM) || up to 18 μL (3 μL ea.)
| |
| |-
| |
| | 10x annealing buffer || 2.0
| |
| |-
| |
| | dH<sub>2</sub>O || ---
| |
| |-
| |
| | || 20 μL --> 100°C (water bath)/ 5 min.; Cool to R.T. overnight
| |
| |}
| |
|
| |
|
|
| |
|