Difference between revisions of "User:Jarle Pahr/Promoters"

From OpenWetWare
Jump to: navigation, search
(pBAD)
Line 2: Line 2:
  
 
OmpA: Among the strongest promoters in E. coli ([http://www.ncbi.nlm.nih.gov/pmc/articles/PMC341223/pdf/nar00303-0094.pdf 1], cited in [http://www.biomedcentral.com/1472-6750/13/12 2]).
 
OmpA: Among the strongest promoters in E. coli ([http://www.ncbi.nlm.nih.gov/pmc/articles/PMC341223/pdf/nar00303-0094.pdf 1], cited in [http://www.biomedcentral.com/1472-6750/13/12 2]).
 +
 +
 +
=Reporter systems=
 +
 +
http://www.weizmann.ac.il/mcb/UriAlon/index.html
  
  

Revision as of 11:22, 15 July 2013

Notes on various promoters:

OmpA: Among the strongest promoters in E. coli (1, cited in 2).


Reporter systems

http://www.weizmann.ac.il/mcb/UriAlon/index.html


XylS/Pm system

pBAD

  • Inducible by l-arabinose
  • Wild-type E. coli show heterogenous (all-or-nothing) induction upon addition of arabinose.
  • Strains for homogenous induction by arabinose have been developed.
  • Subject to catabolite repression.


Regulatable Arabinose-Inducible Gene Expression System with Consistent Control in All Cells of a Culture: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC94830/


Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter.: http://jb.asm.org/content/177/14/4121.full

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC345380/


Repression and catabolite gene activation in the araBAD operon. http://www.ncbi.nlm.nih.gov/pmc/articles/PMC211852/

Lac promoter

lldP

GreA

Promoter sequences

Description Length (bp) Sequence Location (absolute) Location (relative) Comment
LacUV5 Constitutive promoter
rrnB P1 73 bp fragment gttgcgcggtcagaaaattattttaaatttcctcttgtcaggccggaataactccctataatgcgccaccact -70 to +3 Strong promoter. Inhibited by ppGpp.
GreA promoter 60bp fragment ggcgcaacgccctataaagtaaacgatgacccttcgggaacttcagggtaaaatgactAt -58 to +2
PcnB
MazEF
IraP
His
Thr


Links/bibliography

http://wolfson.huji.ac.il/expression/vector/promoters.html