User:Jarle Pahr/Promoters: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
Jarle Pahr (talk | contribs) (→pBAD) |
Jarle Pahr (talk | contribs) No edit summary |
||
Line 2: | Line 2: | ||
OmpA: Among the strongest promoters in E. coli ([http://www.ncbi.nlm.nih.gov/pmc/articles/PMC341223/pdf/nar00303-0094.pdf 1], cited in [http://www.biomedcentral.com/1472-6750/13/12 2]). | OmpA: Among the strongest promoters in E. coli ([http://www.ncbi.nlm.nih.gov/pmc/articles/PMC341223/pdf/nar00303-0094.pdf 1], cited in [http://www.biomedcentral.com/1472-6750/13/12 2]). | ||
=Reporter systems= | |||
http://www.weizmann.ac.il/mcb/UriAlon/index.html | |||
Revision as of 11:22, 15 July 2013
Notes on various promoters:
OmpA: Among the strongest promoters in E. coli (1, cited in 2).
Reporter systems
http://www.weizmann.ac.il/mcb/UriAlon/index.html
XylS/Pm system
pBAD
- Inducible by l-arabinose
- Wild-type E. coli show heterogenous (all-or-nothing) induction upon addition of arabinose.
- Strains for homogenous induction by arabinose have been developed.
- Subject to catabolite repression.
Regulatable Arabinose-Inducible Gene Expression System with Consistent Control in All Cells of a Culture: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC94830/
Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter.: http://jb.asm.org/content/177/14/4121.full
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC345380/
Repression and catabolite gene activation in the araBAD operon. http://www.ncbi.nlm.nih.gov/pmc/articles/PMC211852/
Lac promoter
lldP
GreA
Promoter sequences
Description | Length (bp) | Sequence | Location (absolute) | Location (relative) | Comment |
---|---|---|---|---|---|
LacUV5 | Constitutive promoter | ||||
rrnB P1 73 bp fragment | gttgcgcggtcagaaaattattttaaatttcctcttgtcaggccggaataactccctataatgcgccaccact | -70 to +3 | Strong promoter. Inhibited by ppGpp. | ||
GreA promoter 60bp fragment | ggcgcaacgccctataaagtaaacgatgacccttcgggaacttcagggtaaaatgactAt | -58 to +2 | |||
PcnB | |||||
MazEF | |||||
IraP | |||||
His | |||||
Thr |