Difference between revisions of "User:Jarle Pahr/PCR"

From OpenWetWare
Jump to: navigation, search
(Home-grown polymerase)
Line 73: Line 73:
 
http://www.openbiotech.com/product_p/popentaq.htm
 
http://www.openbiotech.com/product_p/popentaq.htm
  
 +
http://mama.indstate.edu/pfaffle/ptaq/
  
 
==Primers==
 
==Primers==

Revision as of 12:01, 27 March 2013

http://nucleicacids.bitesizebio.com/articles/pcr-rescue/

^^ Tips on getting one band, by using one band of a first PCR as template for a second PCR:


https://eu.idtdna.com/pages/decoded/decoded-articles/core-concepts/decoded/2012/10/08/dna-oligonucleotide-resuspension-and-storage

http://www.spartanbio.com/wp-content/themes/spartan/assets/application_notes/17.pdf

For low-GC templates, some regions of the amplicon may have a melting temperature lower than the extension temperature, causing denaturation during the extension step and failure of the PCR reaction. (http://link.springer.com/article/10.1007%2Fs11274-010-0451-2?LI=true#page-1)


Polymerases

Polymerase Speed (min/kb) Fidelity Supplier Reference 5'-3' Exonuclease? 3'-5' exonuclease (proof reading) Strand displacement? Overhang? Amplicon size
Taq 1 Example ex Yes No Yes 3'-A
Phusion 0.25-0.50 Example NEB https://www.neb.com/protocols/1/01/01/pcr-protocol-m0530 No Yes No No
Pfu 2 Example Example No Yes No
Q5  ? Example NEB

Polymerases: http://oregonstate.edu/instruction/bb492/lectures/DNAI.html

BiteSize Bio - The best polymerases of 2008: http://bitesizebio.com/articles/the-best-polymerases-of-2008/


For a comparison of various polymerases, see http://barricklab.org/twiki/bin/view/Lab/ProtocolsTaq

Phusion polymerase

Note on Phusion polymerase:

Quotes from the protocol:

The final concentration of each primer in a reaction using Phusion DNA Polymerase may be 0.2–1 μM, while 0.5 μM is recommended.

During thermocycling, the denaturation step should be kept to a minimum. Typically, a 5–10 second denaturation at 98°C is recommended for most templates.

Annealing: Annealing temperatures required for use with Phusion tend to be higher than with other PCR polymerases. The NEB Tm calculator should be used to determine the annealing temperature when using Phusion. Typically, primers greater than 20 nucleotides in length anneal for 10–30 seconds at 3°C above the Tm of the lower Tm primer. If the primer length is less than 20 nucleotides, an annealing temperature equivalent to the Tm of the lower primer should be used. A temperature gradient can also be used to optimize


http://bitesizebio.com/articles/mind-your-p%E2%80%99s-and-q%E2%80%99s-a-short-primer-on-proofreading-polymerases/


[Phusion polymerase]

Finnzyme Tm calculator for use with Phusion: http://www.thermoscientificbio.com/webtools/tmc/


Strand displacement:


See https://www.neb.com/products/polymerases-and-amplification-technologies/polymerases-and-amplification-technologies/dna-polymerase-strand-displacement-activity


Home-grown polymerase

http://bitesizebio.com/articles/free-pcr-for-5-years-or-how-to-make-your-own-taq-and-pfu/

http://www.openbiotech.com/product_p/popentaq.htm

http://mama.indstate.edu/pfaffle/ptaq/

Primers

Sequences for SLIC:

Name Length (bp) Sequence Tm (C) [calculated] Tm (C) [Analytical] GC (% / bp) Comment
rrnB p1_74bp_FWD 40 agccgggcgatgccaaccggGTTGCGCGGTCAGAAAATTA For amplification of 74 bp promoter fragments plus SLIC linkers
rrnB p1_74bp_REV 39 ctccattattattgtacatgAGTGGTGGCGCATTATAGG  ?
rrnB_p1_long_FWD 20 agccgggcgatgccaaccggGTATCCTACGCCCGTGGTTA ? For amplification of 389 bp fragment plus SLIC linkers. Use together with rrnB p1_74bp_REV
GreA_60bp_FWD agccgggcgatgccaaccggGGCGCAACGCCCTATAAAGT  ?
GreA_long_FWD 40 agccgggcgatgccaaccggTCACCCTTAAGTACGCCGTT 59 50.00 For amplification of 399bp fragment plus SLIC linkers.
GreA_60bp_REV 45 ctccattattattgtacatgATAGTCATTTTACCCTGAAGTTCCC ?

Sequences for amplification from pSB-M1g:

Name Length (bp) Sequence Tm (C) [calculated] Tm (C) [Analytical] GC (% / bp) Comment
RBS-GFPstart 20 ATGGAGTCATGAACATATGG 56 40 For amplification from pSB-M1g, starting from RBS. Somewhat low GC content, and does not pass 5' end stability check in Clone Manager.
pSB-REV1 20 TCAAGGATGTGGATCTGCTG 57(2)/64.4(1)/57.3(3) 50 For amplification of vector backbone from pSB-M1g. Binds at same site as SeqMG1, between OriT and AgeI. Amplicon includes Colony PCR FWD2 site, but not the Seq5 site.
pSB-REV2 20 CCGGCTTTCTTAGACACTCT 60.5(1) 50 For amplification of vector backbone from pSB-M1g. Binds at beginning of SLIC linker B. Includes Colony PCR FWD2 and Seq5 sites, but not AgeI. Triggers primer dimer warning in Clone Manager.
GFP-END-FWD 20 CCAGATCACATGAAGCAGCA
GFP-END-REV TTTGTATAGTTCATCCATGCC
GFP-END-LVA-EcoRI-BamHI-REV 72 agaggatcccttaagttaagctactaaagcgtagttttcgtcgtttgctgcTTTGTATAGTTCATCCATGCC Primer for amplification of end region of GFP from pSB-M1g with addition of LVA-tag plus EcoRI (italic) and BamHI (bold) sites.



Sequences for restriction-ligation cloning (RL cloning):

Name Length (bp) Sequence Tm (C) [calculated] Tm (C) [Analytical] GC (% / bp) Comment
rrnB p1_74bp_FWD_R caaccggtGTTGCGCGGTCAGAAAATTA
rrnB p1_74bp_REV_R gtacatgtAGTGGTGGCGCATTATAGG
GreA_60bp_FWD_R taaccggtGGCGCAACGCCCTATAAAGT
GreA_60bp_REV_R gtacatgtATAGTCATTTTACCCTGAAGTTCCC
LacUV5_49bp_R_FWD caaccggtGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCG
LacUV5_49bp_R_REV gtacatgtTCCACACATTATACGAGCCGGAAGCATAAAGTGTA
ArgI_46bp_R_FWD caaccggtGCTTTAGACTTGCAAATGAATAATCATCCATAT
ArgI_46bp_R_REV gtacatgtTAAAATTCAATTTATATGGATGATTATTCATTT


Sequences for Ligation-independent cloning (LIC):

Name Length (bp) Sequence Tm (C) [calculated] Tm (C) [Analytical] GC (% / bp) Comment
rrnB74bpLIC_FWD 36 gccgcgcggcagcctgGTTGCGCGGTCAGAAAATTA
rrnB75bpLIC_REV 33 caagaagaacccctAGTGGTGGCGCATTATAGG
GreA_60bpLIC_FWD 36 gccgcgcggcagcctgGGCGCAACGCCCTATAAAGT
GreA_60bpLIC_REV 39 caagaagaacccctATAGTCATTTTACCCTGAAGTTCCC
LacUV5_49bp_R_FWD caaccggtGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCG

For SacII-based LIC sequence, see http://www.nmr.chem.uu.nl/users/rob/protocols/licdetailed.html

Tm notes:

  • 1: Finnzyme/Thermo Scientific Tm Calculator
  • 2: Clone Manager
  • 3: Primer 3




BioBrick sequences:

dNTPs

Average molecular weight: 487 g/mol


Oligomer annealing

http://www.bio.net/bionet/mm/methods/1997-March/056072.html

http://www.protocol-online.org/biology-forums/posts/23721.html

http://www.oligos.com/annOligonucleotides.htm

http://www.addgene.org/plasmid_protocols/annealed_oligo_cloning/


PCR techniques

"sticky end PCR method": Can be used to generate PCR products with restriction site-compatible overhang. Can be used to clone fragments which contain the same restriction site(s) as the vector.


Colony PCR

http://www.csun.edu/~mls42367/Protocols/Colony%20PCR.pdf

http://openwetware.org/wiki/Endy:Colony_PCR_protocol

https://www.researchgate.net/post/Protocol_for_colony_PCR

http://www.benchfly.com/video/57/how-to-perform-colony-pcr/

http://www.methodbook.net/pcr/pcrscreen.html

Emulsion PCR

http://www.plosone.org/article/info:doi/10.1371/journal.pone.0024910

Touchdown PCR

http://bitesizebio.com/articles/touchdown-pcr-a-primer-and-some-tips/


Hot-start

Primer Design

http://www.premierbiosoft.com/tech_notes/PCR_Primer_Design.html

http://www.molecularinfo.com/MTM/E/E1/E1-3.html

Optimization and troubleshooting

http://cshprotocols.cshlp.org/content/2009/4/pdb.ip66.full

http://www.embl.de/pepcore/pepcore_services/cloning/pcr_strategy/optimising_pcr/

http://www.protocol-online.org/biology-forums-2/posts/7644.html


http://www.protocol-online.org/biology-forums/posts/32105.html

http://europepmc.org/articles/PMC145803/pdf/241574.pdf

http://www.eppendorfna.com/int/index.php?l=131&action=products&contentid=109

http://www.bio-rad.com/evportal/en/NO/evolutionPortal.portal?_nfpb=true&_pageLabel=SolutionsLandingPage&catID=LUSO3HC4S

http://originally4.blogspot.no/2011/08/pcr-for-species-with-extreme-gc-content.html

http://forums.biotechniques.com/viewtopic.php?f=2&t=14795

http://books.google.no/books?id=eY4VwJCJLmIC&pg=PA36&lpg=PA36&dq=PCR+pentamer+stability&source=bl&ots=7RpaJimjSl&sig=hwt2K1QO4JiOgiJzPZdtozVZaoE&hl=no&sa=X&ei=-mFGUdmDM4qHtQaX8oEg&ved=0CIwBEOgBMAk#v=onepage&q=PCR%20pentamer%20stability&f=false