Difference between revisions of "User:Jakob G. Wells"

From OpenWetWare
Jump to: navigation, search
Line 1: Line 1:
 
==Contact Info==
 
==Contact Info==
[[Image:OWWEmblem.png|thumb|right|Jakob G. Wells (an artistic interpretation)]]  
+
[[Image:XZEGG.jpg|thumb|right|Jakob G. Wells]]  
  
 
*Jakob G. Wells
 
*Jakob G. Wells

Revision as of 12:40, 8 November 2012

Contact Info

Jakob G. Wells
  • Jakob G. Wells
  • Arizona State University
  • 500 East University Drive
  • Tempe, Arizona, United States
  • Email me

I work in the Your Lab at XYZ University. I learned about OpenWetWare from via email, and I've joined because Requirement for class.

Education

  • Currently seeking a Bachelors in Science and Engineering at Arizona State University

Research interests

Research and Development

Specific Cancer Marker Detection - The Underlying Technology

PCR detection works by heating the DNA sample to about 110°C in order to split the DNA. Then the PCR cools off to 57°C in order for the primer to attach to the DNA strands. The PCR then heats to 72°C so the DNA strand can be re-written. The r17879961 cancer-associated sequence will produce a DNA signal because the reverse primer used, AACTCTTACACTCGATACAT will only attach if the DNA sample has the same coding with the cancer-associated sequence “ACT”. If the DNA sample does not have the cancer-associated sequence the primer will not attach and there will be no DNA signal.

http://openwetware.org/images/3/39/Screen_Shot_2012-11-01_at_3.56.31_PM.png

Source: http://openpcr.org/use-it/

  1. Interest 2
  2. Interest 3

Publications

  1. Goldbeter A and Koshland DE Jr. An amplified sensitivity arising from covalent modification in biological systems. Proc Natl Acad Sci U S A. 1981 Nov;78(11):6840-4. PubMed ID:6947258 | HubMed [Paper1]
  2. JACOB F and MONOD J. Genetic regulatory mechanisms in the synthesis of proteins. J Mol Biol. 1961 Jun;3:318-56. PubMed ID:13718526 | HubMed [Paper2]
    leave a comment about a paper here
  3. ISBN:0879697164 [Book1]
All Medline abstracts: PubMed | HubMed

Useful links