Difference between revisions of "User:David K. Barclay/Notebook/Controlling Pancreas Cell Fate Using Transcription Factors/2014/04/28"

From OpenWetWare
(Autocreate 2014/04/28 Entry for User:David_K._Barclay/Notebook/Controlling_Pancreas_Cell_Fate_Using_Transcription_Factors)
 
(Entry title)
Line 6: Line 6:
 
| colspan="2"|
 
| colspan="2"|
 
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
 
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
==Entry title==
+
==Primers==
* Insert content here...
+
*Created from Roche Applied Science https://www.roche-applied-science.com/shop/CategoryDisplay?catalogId=10001&tab=&identifier=Universal+Probe+Library&langId=-1#tab-3
 
+
{| class="wikitable" style="width: 800px;"
 
+
|- valign="top"
 +
| '''PRIMERS LIST'''
 +
{| width= 700px
 +
|-
 +
| &nbsp; || '''Roche Name''' || '''Left Primer''' || '''Right Primer''' || '''UPL probe'''
 +
|-
 +
| PDX1 || NM_008814.3 || gaaatccaccaaagctcacg || cgggttccgctgtgtaag || #51, cat.no.  04688481001
 +
|-
 +
| MAFA || NM_194350.1 || ctccagagccaggtggag || gtacaggtcccgctccttg || #10, cat.no. 04685091001
 +
|-
 +
| GLP1R || NM_021332.2 || gatgggctcctctcctatca || agatacacgccttccaccag || #15, cat.no. 04685148001
 +
|-
 +
| PCSK1 || NM_013628.2 || tggagttgcatataattccaaagtt || agcctcaatggcatcagttac ||  #42, cat.no. 04688015001
 +
|-
 +
| IAPP || NM_010491.2 || gatgtgcatctccaaactgc || tgtccatctgagggttgcta || #101, cat.no. 04692195001
 +
|-
 +
| KCNQ2 || NM_010611.2 || ctgggcgttcatctaccac || tggaaaacacagaaagcacaa || #2, cat.no. 04684982001
 +
|}
 
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
 
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
 
|}
 
|}
  
 
__NOTOC__
 
__NOTOC__

Revision as of 21:35, 28 April 2014

Owwnotebook icon.png Cell Fate Switch by Synthetic Transcription Factors <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Primers

PRIMERS LIST
  Roche Name Left Primer Right Primer UPL probe
PDX1 NM_008814.3 gaaatccaccaaagctcacg cgggttccgctgtgtaag #51, cat.no. 04688481001
MAFA NM_194350.1 ctccagagccaggtggag gtacaggtcccgctccttg #10, cat.no. 04685091001
GLP1R NM_021332.2 gatgggctcctctcctatca agatacacgccttccaccag #15, cat.no. 04685148001
PCSK1 NM_013628.2 tggagttgcatataattccaaagtt agcctcaatggcatcagttac #42, cat.no. 04688015001
IAPP NM_010491.2 gatgtgcatctccaaactgc tgtccatctgagggttgcta #101, cat.no. 04692195001
KCNQ2 NM_010611.2 ctgggcgttcatctaccac tggaaaacacagaaagcacaa #2, cat.no. 04684982001