Difference between revisions of "User:David K. Barclay/Notebook/Controlling Pancreas Cell Fate Using Transcription Factors/2014/04/28"

From OpenWetWare
Jump to: navigation, search
(Autocreate 2014/04/28 Entry for User:David_K._Barclay/Notebook/Controlling_Pancreas_Cell_Fate_Using_Transcription_Factors)
 
(fix raw html notebook nav)
 
(One intermediate revision by one other user not shown)
Line 2: Line 2:
 
|-
 
|-
 
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> Cell Fate Switch by Synthetic Transcription Factors</span>
 
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> Cell Fate Switch by Synthetic Transcription Factors</span>
|style="background-color: #F2F2F2" align="center"|<html><img src="/images/9/94/Report.png" border="0" /></html> [[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>[[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]]<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>}}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]]<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>}}
+
|style="background-color: #F2F2F2" align="center"|[[File:Report.png|frameless|link={{#sub:{{FULLPAGENAME}}|0|-11}}]][[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|[[File:Resultset_previous.png|frameless|link={{#lnpreventry:{{FULLPAGENAME}}}}]][[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]]&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;}}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]][[File:Resultset_next.png|frameless|link={{#lnnextentry:{{FULLPAGENAME}}}}]]}}
 
|-
 
|-
 
| colspan="2"|
 
| colspan="2"|
 
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
 
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
==Entry title==
+
==Primers==
* Insert content here...
+
*Created from Roche Applied Science https://www.roche-applied-science.com/shop/CategoryDisplay?catalogId=10001&tab=&identifier=Universal+Probe+Library&langId=-1#tab-3
 
+
{| class="wikitable" style="width: 800px;"
 
+
|- valign="top"
 +
| '''PRIMERS LIST'''
 +
{| width= 700px
 +
|-
 +
| &nbsp; || '''Roche Name''' || '''Left Primer''' || '''Right Primer''' || '''UPL probe'''
 +
|-
 +
| PDX1 || NM_008814.3 || gaaatccaccaaagctcacg || cgggttccgctgtgtaag || #51, cat.no.  04688481001
 +
|-
 +
| MAFA || NM_194350.1 || ctccagagccaggtggag || gtacaggtcccgctccttg || #10, cat.no. 04685091001
 +
|-
 +
| GLP1R || NM_021332.2 || gatgggctcctctcctatca || agatacacgccttccaccag || #15, cat.no. 04685148001
 +
|-
 +
| PCSK1 || NM_013628.2 || tggagttgcatataattccaaagtt || agcctcaatggcatcagttac ||  #42, cat.no. 04688015001
 +
|-
 +
| IAPP || NM_010491.2 || gatgtgcatctccaaactgc || tgtccatctgagggttgcta || #101, cat.no. 04692195001
 +
|-
 +
| KCNQ2 || NM_010611.2 || ctgggcgttcatctaccac || tggaaaacacagaaagcacaa || #2, cat.no. 04684982001
 +
|}
 
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
 
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
 
|}
 
|}
  
 
__NOTOC__
 
__NOTOC__

Latest revision as of 22:56, 26 September 2017

Owwnotebook icon.png Cell Fate Switch by Synthetic Transcription Factors Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Primers

PRIMERS LIST
  Roche Name Left Primer Right Primer UPL probe
PDX1 NM_008814.3 gaaatccaccaaagctcacg cgggttccgctgtgtaag #51, cat.no. 04688481001
MAFA NM_194350.1 ctccagagccaggtggag gtacaggtcccgctccttg #10, cat.no. 04685091001
GLP1R NM_021332.2 gatgggctcctctcctatca agatacacgccttccaccag #15, cat.no. 04685148001
PCSK1 NM_013628.2 tggagttgcatataattccaaagtt agcctcaatggcatcagttac #42, cat.no. 04688015001
IAPP NM_010491.2 gatgtgcatctccaaactgc tgtccatctgagggttgcta #101, cat.no. 04692195001
KCNQ2 NM_010611.2 ctgggcgttcatctaccac tggaaaacacagaaagcacaa #2, cat.no. 04684982001