User:David K. Barclay/Notebook/Controlling Pancreas Cell Fate Using Transcription Factors/2014/04/28: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
(Autocreate 2014/04/28 Entry for User:David_K._Barclay/Notebook/Controlling_Pancreas_Cell_Fate_Using_Transcription_Factors) |
(fix raw html notebook nav) |
||
(One intermediate revision by one other user not shown) | |||
Line 2: | Line 2: | ||
|- | |- | ||
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> Cell Fate Switch by Synthetic Transcription Factors</span> | |style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> Cell Fate Switch by Synthetic Transcription Factors</span> | ||
|style="background-color: #F2F2F2" align="center"| | |style="background-color: #F2F2F2" align="center"|[[File:Report.png|frameless|link={{#sub:{{FULLPAGENAME}}|0|-11}}]][[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|[[File:Resultset_previous.png|frameless|link={{#lnpreventry:{{FULLPAGENAME}}}}]][[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]] }}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]][[File:Resultset_next.png|frameless|link={{#lnnextentry:{{FULLPAGENAME}}}}]]}} | ||
|- | |- | ||
| colspan="2"| | | colspan="2"| | ||
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit above this line unless you know what you are doing. ##### --> | ||
== | ==Primers== | ||
* | *Created from Roche Applied Science https://www.roche-applied-science.com/shop/CategoryDisplay?catalogId=10001&tab=&identifier=Universal+Probe+Library&langId=-1#tab-3 | ||
{| class="wikitable" style="width: 800px;" | |||
|- valign="top" | |||
| '''PRIMERS LIST''' | |||
{| width= 700px | |||
|- | |||
| || '''Roche Name''' || '''Left Primer''' || '''Right Primer''' || '''UPL probe''' | |||
|- | |||
| PDX1 || NM_008814.3 || gaaatccaccaaagctcacg || cgggttccgctgtgtaag || #51, cat.no. 04688481001 | |||
|- | |||
| MAFA || NM_194350.1 || ctccagagccaggtggag || gtacaggtcccgctccttg || #10, cat.no. 04685091001 | |||
|- | |||
| GLP1R || NM_021332.2 || gatgggctcctctcctatca || agatacacgccttccaccag || #15, cat.no. 04685148001 | |||
|- | |||
| PCSK1 || NM_013628.2 || tggagttgcatataattccaaagtt || agcctcaatggcatcagttac || #42, cat.no. 04688015001 | |||
|- | |||
| IAPP || NM_010491.2 || gatgtgcatctccaaactgc || tgtccatctgagggttgcta || #101, cat.no. 04692195001 | |||
|- | |||
| KCNQ2 || NM_010611.2 || ctgggcgttcatctaccac || tggaaaacacagaaagcacaa || #2, cat.no. 04684982001 | |||
|} | |||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
|} | |} | ||
__NOTOC__ | __NOTOC__ |
Latest revision as of 23:56, 26 September 2017
Cell Fate Switch by Synthetic Transcription Factors | Main project page Previous entry Next entry | ||||||||||||||||||||||||||||||||||||
Primers
|