User:Benji Moncivaiz

From OpenWetWare
Revision as of 18:26, 6 November 2010 by Benji Moncivaiz (talk | contribs) (Telephone #)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search

Contact Info

Benji Moncivaiz (an artistic interpretation)


Day1: Protein Engineering with PCR assignment

Forward primer: FLAP landing sequence 5’ CAAATAAGGGAATTTCTTGAAGAGATTGTAGATACACAA tccatggaaaagagaagatg 3’

Reverse Primer: FLAP landing sequence 5’ TGT AAT AAT ATT GGG AAT TAA GGT GCA TTT TCG TAT CCT tacgactcactatagggcga 3’


  • Year, PhD, Institute
  • Year, MS, Institute
  • Year, BS, Institute

Research interests

  1. Interest 1
  2. Interest 2
  3. Interest 3


  1. Goldbeter A and Koshland DE Jr. An amplified sensitivity arising from covalent modification in biological systems. Proc Natl Acad Sci U S A. 1981 Nov;78(11):6840-4. PubMed ID:6947258 | HubMed [Paper1]
  2. JACOB F and MONOD J. Genetic regulatory mechanisms in the synthesis of proteins. J Mol Biol. 1961 Jun;3:318-56. PubMed ID:13718526 | HubMed [Paper2]
    leave a comment about a paper here
  3. Mark Ptashne. A genetic switch. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press, 2004. ISBN:0879697164 [Book1]
All Medline abstracts: PubMed | HubMed

Please copy the source code from this page to your user page, fill in the answers and print out a copy for next time.
You do not need to keep the information on your user page once you've printed it out.

Registration/Questionnaire: 20.109 Fall 2008

Last Name

Moncivaiz II

First Name


Preferred name



2 / (20&4)

Year of Graduation


Telephone #


benmonci AT mit DOT edu

Have you taken or are you taking...

7.05/5.07 (Biochemistry) Not yet.
7.06 (Cell Biology) No.
7.02 (General Biology Lab) Nope.
5.310 (General Chemistry Lab) Definitely not :)

Do you have any experience culturing cells (mammalian, yeast or microbial)?

Do you have any experience in molecular biology (electrophoresis, PCR, etc)?

Please briefly describe any previous laboratory experience

I worked in a lab with HST. I was fabricating microwells made of polyethylene glycol (PEG) with "stamps" made from DMSO. I was also printing A6 polymer into these microwells, hoping later to find any effects A6 had on the cells our collaborators cultured in them. I did not get to work with any of the cells (staining, passaging) or do any work under the hood, but I got to do a lot of work leading up to that and making it possible!

Anything else you would like us to know?

I am basically a clean slate, as you can tell, and I am excited to get my hands on some good biology!

Useful links