Difference between revisions of "TdTomato"

From OpenWetWare
Jump to: navigation, search
Line 1: Line 1:
 
<showhide>'''Sequence'''__HIDER__
 
<showhide>'''Sequence'''__HIDER__
 
<hide>
 
<hide>
atggtgagcaagggcgaggaggtcatcaaagagttcatgcgcttcaaggtgcgcatggag
+
<nowiki>atggtgagcaagggcgaggaggtcatcaaagagttcatgcgcttcaaggtgcgcatggag
 
ggctccatgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgag
 
ggctccatgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgag
 
ggcacccagaccgccaagctgaaggtgaccaagggcggccccctgcccttcgcctgggac
 
ggcacccagaccgccaagctgaaggtgaccaagggcggccccctgcccttcgcctgggac
Line 24: Line 24:
 
aagaccatctacatggccaagaagcccgtgcaactgcccggctactactacgtggacacc
 
aagaccatctacatggccaagaagcccgtgcaactgcccggctactactacgtggacacc
 
aagctggacatcacctcccacaacgaggactacaccatcgtggaacagtacgagcgctcc
 
aagctggacatcacctcccacaacgaggactacaccatcgtggaacagtacgagcgctcc
gagggccgccaccacctgttcctgtacggcatggacgagctgtacaagtaa
+
gagggccgccaccacctgttcctgtacggcatggacgagctgtacaagtaa</nowiki>
 
</hide></showhide>
 
</hide></showhide>
  

Revision as of 16:33, 30 May 2006

<showhide>Sequence__HIDER__ <hide> atggtgagcaagggcgaggaggtcatcaaagagttcatgcgcttcaaggtgcgcatggag ggctccatgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgag ggcacccagaccgccaagctgaaggtgaccaagggcggccccctgcccttcgcctgggac atcctgtccccccagttcatgtacggctccaaggcgtacgtgaagcaccccgccgacatc cccgattacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttc gaggacggcggtctggtgaccgtgacccaggactcctccctgcaggacggcacgctgatc tacaaggtgaagatgcgcggcaccaacttcccccccgacggccccgtaatgcagaagaag accatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctgaagggc gagatccaccaggccctgaagctgaaggacggcggccactacctggtggagttcaagacc atctacatggccaagaagcccgtgcaactgcccggctactactacgtggacaccaagctg gacatcacctcccacaacgaggactacaccatcgtggaacagtacgagcgctccgagggc cgccaccacctgttcctggggcatggcaccggcagcaccggcagcggcagctccggcacc gcctcctccgaggacaacaacatggccgtcatcaaagagttcatgcgcttcaaggtgcgc atggagggctccatgaacggccacgagttcgagatcgagggcgagggcgagggccgcccc tacgagggcacccagaccgccaagctgaaggtgaccaagggcggccccctgcccttcgcc tgggacatcctgtccccccagttcatgtacggctccaaggcgtacgtgaagcaccccgcc gacatccccgattacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatg aacttcgaggacggcggtctggtgaccgtgacccaggactcctccctgcaggacggcacg ctgatctacaaggtgaagatgcgcggcaccaacttcccccccgacggccccgtaatgcag aagaagaccatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctg aagggcgagatccaccaggccctgaagctgaaggacggcggccactacctggtggagttc aagaccatctacatggccaagaagcccgtgcaactgcccggctactactacgtggacacc aagctggacatcacctcccacaacgaggactacaccatcgtggaacagtacgagcgctcc gagggccgccaccacctgttcctgtacggcatggacgagctgtacaagtaa </hide></showhide>

Reference

  1. Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE, and Tsien RY. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol. 2004 Dec;22(12):1567-72. DOI:10.1038/nbt1037 | PubMed ID:15558047 | HubMed [Tsien]