Difference between revisions of "Talk:20.109(S13):Context-setting and primer design (Day1)"

From OpenWetWare
Jump to: navigation, search
Line 175: Line 175:
|CTGTCTTGGTAGTCCACTAC <br>Agi: CTG TCT TGG TAG TCC '''ATTAC''' AC TAC (5 insertions -- but no sequence that I found matches yours, most only require 1 insertion -- so check your work)
|bp 14
|bp 14
|bp 203
|bp 203

Revision as of 13:42, 15 February 2013

Update for everyone

As explained in pre-lab lecture, we were remiss (mainly me, Agi!) in not providing you with the best sequence information for V corneae. Moreover, we told you to shoot for a Tm of 58 °C instead of a Tm of 63 °C (Ta of 58 °C).

Below, we have listed modified primer sequences (just under your originals) that match the Broad sequence. An ApE file of this sequence is linked here. For comparison, the complete sequences from Baker et al and [[<edia:Vcorneae_SUU-complete-DaSilva.gb DaSilva et al.] are each linked. You can Align Sequences (under Tools) in ApE to see the differences for yourself.In progress for WF.

As a default, we will order these primers on Tuesday for arrival on Thursday, and run two separate PCRs: one at Ta = 58 °C and one at Ta = 53 °C.

However, if you would like to revise your primers to a Tm of 63 °C, we will accept these new designs through Monday at 9 pm.

T/R section

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.


Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Grey (Platinum) :) CAT GCT TGC CAA CAC AG
Agi: PT so unchanged
Agi: PT so unchanged
bp 9 bp 251 E. Hellem: polar tube protein gene
Agi: fine
bp 5 bp 236 VC: SSU rRNA
Pink ttctgcctgacgtagatg
Agi: fine
bp 12 bp 226 VC
Agi: ctg acg tag atg cta gtc
Agi: fine
bp 18 bp 199 VC small subunit ribosomal RNA gene


Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Agi: fine
Agi: fine
bp 93, F bp 879, R VC, SSU rRNA
Agi: CCT TCG TCC TTG ATC ACC GAA T (yours doesn't match any known sequence in last 4 bp -- do I have right region?)
bp 6, F bp 588, R VC, SSU RNA
Orange 5'cgt agt cat aga agg gca aag ag3'
Agi: fine
5' ctc tct ctc tac ctg cta ttg ta 3'
Agi: fine
441 1005 V. corneae TV4/TV5 SSU rRNA
Agi: fine
GTCAACGTCACTGTCTTGG<bra>Agi: GTC AAC C GTC ACT GTC TTG G (insertion) 60 195 V. corneae TV4/TV5 SSU rRNA

W/F section

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.


Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Red 5' CCA GGT TGA TTC TGC CTG 3' 5' CTC TCC GGA ACC AAA CC 3' bp 9, F bp 225, R VC, SSU, rRNA
Platinum 5' CAT GTT GAT TCT GCC TGA C 3' 5' CTC TCC TGA ACC AAA CCC TG 3' bp 4, F bp 278, R EH, SSU rRNA


Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Agi: fine
Agi: fine
bp 12 bp 213 for VC TV4 SSU rRNA
Agi: fine
Agi: fine
bp 64 bp 169 VC SSU rRNA, full sequence
Agi: fine
Agi: CTG TCT TGG TAG TCC ATTAC AC TAC (5 insertions -- but no sequence that I found matches yours, most only require 1 insertion -- so check your work)
bp 14 bp 203 VC TV4 SSU rRNA gene
Agi: fine
Agi: fine
bp 841 bp 1049 VC SSU rRNA