Difference between revisions of "Talk:20.109(S13):Context-setting and primer design (Day1)"

From OpenWetWare
Jump to: navigation, search
(Specificity)
(Specificity)
Line 152: Line 152:
 
|-  
 
|-  
 
| Blue
 
| Blue
|
+
| TBA
|
+
| TBA
|
+
| TBA
|
+
| TBA
|
+
| TBA
 
|-
 
|-
 
|  
 
|  

Revision as of 17:03, 8 February 2013

T/R section

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Grey (Platinum) :) ccagccaggacagaatggag GGA GAT AAC ACC TGG AAT GGT CTG
Green
Pink
Yellow


Specificity

Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Purple
Red
Orange
Blue CCGCAATCAGGGACGAA GTCAACGTCACTGTCTTGG 60 195 V. corneae TV4/TV5 SSU rRNA


W/F section

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?


Specificity

Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Blue TBA TBA TBA TBA TBA