Difference between revisions of "Talk:20.109(S13):Context-setting and primer design (Day1)"

From OpenWetWare
Jump to: navigation, search
Line 162: Line 162:
|bp 29
|bp 29
|for VC, E hellum is AF039229
|for VC TV4 SSU rRNA

Revision as of 11:53, 11 February 2013

T/R section

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.


Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Grey (Platinum) :) CCA TGC TTG CCA ACA CAG G GGT CTG GTT GCT TCC ACT TCC bp 8 bp 227 E. Hellem: polar tube protein gene
Yellow CTGACGTGGATGCTATTC CCGTCAACCGTCACTGTC bp 18 bp 199 VC small subunit ribosomal RNA gene


Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?

W/F section

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.


Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?


Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Pink gctagtctctaagattaagcc tcccgtcaaccgtcactgtc bp 29 bp199 for VC TV4 SSU rRNA